Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Errors thrown when giving amplicon_seq in lower case. #396

Closed
francoiskroll opened this issue Mar 19, 2024 · 0 comments
Closed

Errors thrown when giving amplicon_seq in lower case. #396

francoiskroll opened this issue Mar 19, 2024 · 0 comments

Comments

@francoiskroll
Copy link

Hi – Could it be that issue #187 was not fully resolved?

I am using crispresso2 2.2.15.

If I run (note --amplicon_seq all in lowercase)

CRISPResso --fastq_r1 ./D11_S47_L001_R1_001.fastq --fastq_r2 ./D11_S47_L001_R2_001.fastq --amplicon_seq gtacagtctggtgtggctcataagccccattttgggttttatcctacagcccgtcatcggctcggcgagcgactactgtaggtcgtcataaggccgaaggagaccgtacatactcttactggggattctgatgttagtgggcatgactttatttctaaatggagatgcagtcacaacaggtgggtga --amplicon_name slc45a2TAA --prime_editing_pegRNA_spacer_seq gactactgtaggtcgtcata --prime_editing_pegRNA_extension_seq tctccttcggccccatgacgacctacagt --prime_editing_pegRNA_scaffold_seq gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtgggaccgagtcggtcc

It says:

ERROR: The given prime editing pegRNA spacer is not found in the reference sequence.

But the spacer is in the reference/amplicon sequence.

The analysis runs if I use (note --amplicon_seq all in uppercase):

CRISPResso --fastq_r1 ./D11_S47_L001_R1_001.fastq --fastq_r2 ./D11_S47_L001_R2_001.fastq --amplicon_seq GTACAGTCTGGTGTGGCTCATAAGCCCCATTTTGGGTTTTATCCTACAGCCCGTCATCGGCTCGGCGAGCGACTACTGTAGGTCGTCATAAGGCCGAAGGAGACCGTACATACTCTTACTGGGGATTCTGATGTTAGTGGGCATGACTTTATTTCTAAATGGAGATGCAGTCACAACAGGTGGGTGA --amplicon_name slc45a2TAA --prime_editing_pegRNA_spacer_seq gactactgtaggtcgtcata --prime_editing_pegRNA_extension_seq tctccttcggccccatgacgacctacagt --prime_editing_pegRNA_scaffold_seq gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtgggaccgagtcggtcc

If you find the time, can I also suggest giving an example of a command used for prime editing in the README? For example, the README give the suggested --prime_editing_pegRNA_scaffold_seq as RNA (U instead of T), which confused me somewhat. I thought I was meant to give all RNA sequences as actual RNA, while clearly the above works fine.

Colelyman added a commit to edilytics/CRISPResso2 that referenced this issue Mar 28, 2024
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Apr 4, 2024
* Move read filtering to after merging in CRISPResso (#39)

* Move read filtering to after merging

This is in an effort to be consistent with the behavior and results of
CRISPRessoPooled.

* Properly assign the correct file names for read filtering

* Add space around operators

* GitHub actions on pr (#51)

* Run integration tests on pull_request

* Run pytest on pull_request

* Run pylint on pull_request

* Run tests on PR only when opening PR (#53)

* Update reports (#52)

* Update report changes

* Switch branch of integration test repo

* Remove extraneous `crispresso_data_path`

* Point integration tests back to master

* Make all amplicons in amplicon_seq_arr uppercase

This fixes pinellolab#396

* Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

* Fix 'Prime-edited' key not found (#32)

* Move 'Prime-edited' amplicon name check

By moving this, it will check if there is an amplicon named
'Prime-edited' (which is a reserved name) even if the
`prime_editing_pegRNA_extension_seq` parameter is empty.

* Only search for scaffold integration when pegRNA extension seq is provided

* Remove spaces at the end of lines

* Docker size (#49)

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* 3.4->2.08

* Put ttf-mscorefonts-installer back above apt-get clean

* restore slash, replace fastp with trimmomatic and flash, add autoremove step

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Guardrails clean history (#34)

* Include guardrail functions

* Add CRISPRessoReports subtree

* Refactor to use CRISPRessoReports module

* Include guardrail functions

* Functional guardrails, needs reports update

* Add guardrail partial

* fix guardrials partial

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Update C cythonized files

* Add exact numbers to guardrails printouts

* Remove extraneous whitespace from CRISPRessoCOREResources.pyx

* Fix calculation of `total_mods` from being negative

The issue was that `all_deletion_coordinates` just tells you how many deletions
were present, but not how long the deletion is.

* Changes to message

* Remove old tag

* Point tests at guardrails

* Restore C2 pro check

* Save message with guardrail name

* Point tests repo at master

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

---------

Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: trevormartinj7 <trevormartinj7@gmail.com>
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Apr 4, 2024
* Move read filtering to after merging in CRISPResso (#39)

* Move read filtering to after merging

This is in an effort to be consistent with the behavior and results of
CRISPRessoPooled.

* Properly assign the correct file names for read filtering

* Add space around operators

* GitHub actions on pr (#51)

* Run integration tests on pull_request

* Run pytest on pull_request

* Run pylint on pull_request

* Run tests on PR only when opening PR (#53)

* Update reports (#52)

* Update report changes

* Switch branch of integration test repo

* Remove extraneous `crispresso_data_path`

* Point integration tests back to master

* Make all amplicons in amplicon_seq_arr uppercase

This fixes pinellolab#396

* Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

* Fix 'Prime-edited' key not found (#32)

* Move 'Prime-edited' amplicon name check

By moving this, it will check if there is an amplicon named
'Prime-edited' (which is a reserved name) even if the
`prime_editing_pegRNA_extension_seq` parameter is empty.

* Only search for scaffold integration when pegRNA extension seq is provided

* Remove spaces at the end of lines

* Docker size (#49)

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* 3.4->2.08

* Put ttf-mscorefonts-installer back above apt-get clean

* restore slash, replace fastp with trimmomatic and flash, add autoremove step

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Guardrails clean history (#34)

* Include guardrail functions

* Add CRISPRessoReports subtree

* Refactor to use CRISPRessoReports module

* Include guardrail functions

* Functional guardrails, needs reports update

* Add guardrail partial

* fix guardrials partial

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Update C cythonized files

* Add exact numbers to guardrails printouts

* Remove extraneous whitespace from CRISPRessoCOREResources.pyx

* Fix calculation of `total_mods` from being negative

The issue was that `all_deletion_coordinates` just tells you how many deletions
were present, but not how long the deletion is.

* Changes to message

* Remove old tag

* Point tests at guardrails

* Restore C2 pro check

* Save message with guardrail name

* Point tests repo at master

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

---------

Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: trevormartinj7 <trevormartinj7@gmail.com>
@kclem kclem closed this as completed in 235dc29 Apr 5, 2024
Snicker7 added a commit to edilytics/CRISPResso2 that referenced this issue Apr 23, 2024
commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
Author: Kendell Clement <k.clement.dev@gmail.com>
Date:   Mon Apr 22 11:24:59 2024 -0600

    Update CRISPRessoPooledCORE.py (#423)

    Fix bug in error reporting if duplicate names are present

commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
Author: Cole Lyman <Cole@colelyman.com>
Date:   Thu Apr 18 16:55:39 2024 -0600

    Remove extra imports from CRISPRessoCore (#67) (#422)

commit 4aae57e5be475cd717792265bee36a71a99425de
Author: Cole Lyman <Cole@colelyman.com>
Date:   Thu Apr 18 10:00:19 2024 -0600

    Cole/refactor jinja undefined (#66) (#421)

    * Replace Jinja2 PackageLoader with FileSystemLoader

    The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
    and Python 3.9. Replacing with FileSystemLoader work with the older version and
    the latest version.

    * Fix undefined variable `amplicon_name` in report template

    * Refactor logging Jinja2 undefined variable warnings

    * Revert plot_11a update

    * Update intedration test branch

    * Update jinja to warn on undefined but not fail. Fix all undefined warnings

    * Fix github integration tests ref

    * One more undefined variable

    ---------

    Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
Author: Cole Lyman <Cole@colelyman.com>
Date:   Tue Apr 9 17:30:10 2024 -0600

    Fix Jinja2 undefined variables (#63) (#417)

    * Replace Jinja2 PackageLoader with FileSystemLoader

    The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
    and Python 3.9. Replacing with FileSystemLoader work with the older version and
    the latest version.

    * Fix undefined variable `amplicon_name` in report template

    * Revert plot_11a update

    * Update intedration test branch

    * Update branch for integration tests

commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
Author: Han Dai <github@daihan.me>
Date:   Fri Apr 5 18:36:41 2024 -0400

    fix: change all U+00A0 to U+0020 (#400)

commit 235dc29c0cd0fcca2e999148d4660acf00b07221
Author: Cole Lyman <Cole@colelyman.com>
Date:   Fri Apr 5 16:36:16 2024 -0600

    Fastp, args as data, guardrails, and PE fix (#415)

    * Change CRISPResso_status.txt format to JSON (#46)

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * add json read for status file

    * changed Formatter to json format

    * fixed json access variable name: message

    * changed  perentage_complete to numeric

    * changed status file to .json

    * Create integration_tests.yml

    * Simplify name

    * CRISPRESSO2_DIR environment variable

    * Up one dir

    * ls workspace

    * Install CRISPResso and ydiff

    * Clone repo instead of checkout

    * submodule

    * ls

    * CRISPResso2_copy

    * ls

    * Update env

    * Simplify

    * Pull from githubactions branch

    * Pull githubactions repo

    * Checkout githubactions

    * Run tests individually

    * Pin plotly version

    * Run all tests even if one fails

    * Test on another branch

    * Switch branch with token

    * Update integration_tests.yml

    * New makefile commands

    * changed file to .json

    * changed status to json file

    * Make JSON human readable by adding new lines

    * GitHub actions integration tests (#48)

    * GitHub actions clean (#40)

    * Create pytest.yml

    * Create pylint.yml

    * Create .pylintrc

    * Create test_env.yml

    * Full path

    * Remove conda install

    * Replace path

    * Pytest tests

    * pip -e

    * Create integration_tests.yml

    * Simplify name

    * CRISPRESSO2_DIR environment variable

    * Up one dir

    * ls workspace

    * Install CRISPResso and ydiff

    * Clone repo instead of checkout

    * submodule

    * ls

    * CRISPResso2_copy

    * ls

    * Update env

    * Simplify

    * Pull from githubactions branch

    * Pull githubactions repo

    * Checkout githubactions

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Run tests individually

    * Pin plotly version

    * Run all tests even if one fails

    * Test on another branch

    * Switch branch with token

    * Update integration_tests.yml

    * Introduce pandas sorting in CRISPRessoCompare (#47)

    * New makefile commands

    * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

    * Extract out split_interleaved_fastq function to CRISPRessoShared

    * Implement splitting interleaved fastq files in CRISPRessoPooled

    * Suppress split_interleaved_input from CRISPRessoWGS parameters

    * Suppress other parameters in CRISPRessoWGS

    * Move where interleaved fastq files are split to be trimmed properly

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * On push no branches

    * On push no branches

    * All in one file

    * Fix yml errors

    * Rename jobs

    * Remove old workflow files

    * Remove paths

    * Run jobs in parallel

    ---------

    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Move read filtering to after merging in CRISPResso (#39)

    * Move read filtering to after merging

    This is in an effort to be consistent with the behavior and results of
    CRISPRessoPooled.

    * Properly assign the correct file names for read filtering

    * Add space around operators

    * GitHub actions on pr (#51)

    * Run integration tests on pull_request

    * Run pytest on pull_request

    * Run pylint on pull_request

    * Run tests on PR only when opening PR (#53)

    * Update reports (#52)

    * Update report changes

    * Switch branch of integration test repo

    * Remove extraneous `crispresso_data_path`

    * Point integration tests back to master

    * point to test branch

    * pointed CI config to testing branch

    * Update integration_tests.yml

    point to master

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>
    Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    * Trevor/fastp integration (#50)

    * Update check_program to check versions and create check_fastq function

    * Update fastq arg, implement fastp in get_most_frequent_reads

    * Bump version to 2.3.0

    * Deprecate Flash and Trimmomatic parameters, and update fastp params

    * Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

    * Implement trimming of single end reads

    * Merge (and trim) reads in CRISPRessoCORE with fastp

    * Modify error handling to account for fastp errors

    * Replace flash and trimmomatic with fastp in Docker dependencies

    * Update LICENSE.txt with fastp info

    * Remove min and max amplicon length (no longer needed)

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Implement trimming with fastp in CRISPRessoPooled

    * Implemend merging (and trimming) with fastp in CRISPRessoPooled

    * Fixed minor fastp errors

    * Move read filtering to after merging in CRISPResso (#39)

    * Move read filtering to after merging

    This is in an effort to be consistent with the behavior and results of
    CRISPRessoPooled.

    * Properly assign the correct file names for read filtering

    * Add space around operators

    * GitHub actions on pr (#51)

    * Run integration tests on pull_request

    * Run pytest on pull_request

    * Run pylint on pull_request

    * Run tests on PR only when opening PR (#53)

    * Update reports (#52)

    * Update report changes

    * Switch branch of integration test repo

    * Remove extraneous `crispresso_data_path`

    * Point integration tests back to master

    * Update where the test point to

    * Fix 'Prime-edited' key not found (#32)

    * Move 'Prime-edited' amplicon name check

    By moving this, it will check if there is an amplicon named
    'Prime-edited' (which is a reserved name) even if the
    `prime_editing_pegRNA_extension_seq` parameter is empty.

    * Only search for scaffold integration when pegRNA extension seq is provided

    * Remove spaces at the end of lines

    * Docker size (#49)

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * GitHub actions integration tests (#48)

    * GitHub actions clean (#40)

    * Create pytest.yml

    * Create pylint.yml

    * Create .pylintrc

    * Create test_env.yml

    * Full path

    * Remove conda install

    * Replace path

    * Pytest tests

    * pip -e

    * Create integration_tests.yml

    * Simplify name

    * CRISPRESSO2_DIR environment variable

    * Up one dir

    * ls workspace

    * Install CRISPResso and ydiff

    * Clone repo instead of checkout

    * submodule

    * ls

    * CRISPResso2_copy

    * ls

    * Update env

    * Simplify

    * Pull from githubactions branch

    * Pull githubactions repo

    * Checkout githubactions

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Run tests individually

    * Pin plotly version

    * Run all tests even if one fails

    * Test on another branch

    * Switch branch with token

    * Update integration_tests.yml

    * Introduce pandas sorting in CRISPRessoCompare (#47)

    * New makefile commands

    * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

    * Extract out split_interleaved_fastq function to CRISPRessoShared

    * Implement splitting interleaved fastq files in CRISPRessoPooled

    * Suppress split_interleaved_input from CRISPRessoWGS parameters

    * Suppress other parameters in CRISPRessoWGS

    * Move where interleaved fastq files are split to be trimmed properly

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * On push no branches

    * On push no branches

    * All in one file

    * Fix yml errors

    * Rename jobs

    * Remove old workflow files

    * Remove paths

    * Run jobs in parallel

    ---------

    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * 3.4->2.08

    * Put ttf-mscorefonts-installer back above apt-get clean

    * restore slash, replace fastp with trimmomatic and flash, add autoremove step

    ---------

    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * initial readme modifications

    * Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

    * Pointing test branch back at master

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>
    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    * Guardrails clean history (#34)

    * Include guardrail functions

    * Add CRISPRessoReports subtree

    * Refactor to use CRISPRessoReports module

    * Include guardrail functions

    * Functional guardrails, needs reports update

    * Add guardrail partial

    * fix guardrials partial

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * GitHub actions integration tests (#48)

    * GitHub actions clean (#40)

    * Create pytest.yml

    * Create pylint.yml

    * Create .pylintrc

    * Create test_env.yml

    * Full path

    * Remove conda install

    * Replace path

    * Pytest tests

    * pip -e

    * Create integration_tests.yml

    * Simplify name

    * CRISPRESSO2_DIR environment variable

    * Up one dir

    * ls workspace

    * Install CRISPResso and ydiff

    * Clone repo instead of checkout

    * submodule

    * ls

    * CRISPResso2_copy

    * ls

    * Update env

    * Simplify

    * Pull from githubactions branch

    * Pull githubactions repo

    * Checkout githubactions

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Run tests individually

    * Pin plotly version

    * Run all tests even if one fails

    * Test on another branch

    * Switch branch with token

    * Update integration_tests.yml

    * Introduce pandas sorting in CRISPRessoCompare (#47)

    * New makefile commands

    * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

    * Extract out split_interleaved_fastq function to CRISPRessoShared

    * Implement splitting interleaved fastq files in CRISPRessoPooled

    * Suppress split_interleaved_input from CRISPRessoWGS parameters

    * Suppress other parameters in CRISPRessoWGS

    * Move where interleaved fastq files are split to be trimmed properly

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * On push no branches

    * On push no branches

    * All in one file

    * Fix yml errors

    * Rename jobs

    * Remove old workflow files

    * Remove paths

    * Run jobs in parallel

    ---------

    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Update C cythonized files

    * Add exact numbers to guardrails printouts

    * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

    * Fix calculation of `total_mods` from being negative

    The issue was that `all_deletion_coordinates` just tells you how many deletions
    were present, but not how long the deletion is.

    * Changes to message

    * Remove old tag

    * Point tests at guardrails

    * Restore C2 pro check

    * Save message with guardrail name

    * Point tests repo at master

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>
    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    * Fix case sensitivity in Prime Editing mode (#54)

    * Move read filtering to after merging in CRISPResso (#39)

    * Move read filtering to after merging

    This is in an effort to be consistent with the behavior and results of
    CRISPRessoPooled.

    * Properly assign the correct file names for read filtering

    * Add space around operators

    * GitHub actions on pr (#51)

    * Run integration tests on pull_request

    * Run pytest on pull_request

    * Run pylint on pull_request

    * Run tests on PR only when opening PR (#53)

    * Update reports (#52)

    * Update report changes

    * Switch branch of integration test repo

    * Remove extraneous `crispresso_data_path`

    * Point integration tests back to master

    * Make all amplicons in amplicon_seq_arr uppercase

    This fixes https://github.com/pinellolab/CRISPResso2/issues/396

    * Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

    * Fix 'Prime-edited' key not found (#32)

    * Move 'Prime-edited' amplicon name check

    By moving this, it will check if there is an amplicon named
    'Prime-edited' (which is a reserved name) even if the
    `prime_editing_pegRNA_extension_seq` parameter is empty.

    * Only search for scaffold integration when pegRNA extension seq is provided

    * Remove spaces at the end of lines

    * Docker size (#49)

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * GitHub actions integration tests (#48)

    * GitHub actions clean (#40)

    * Create pytest.yml

    * Create pylint.yml

    * Create .pylintrc

    * Create test_env.yml

    * Full path

    * Remove conda install

    * Replace path

    * Pytest tests

    * pip -e

    * Create integration_tests.yml

    * Simplify name

    * CRISPRESSO2_DIR environment variable

    * Up one dir

    * ls workspace

    * Install CRISPResso and ydiff

    * Clone repo instead of checkout

    * submodule

    * ls

    * CRISPResso2_copy

    * ls

    * Update env

    * Simplify

    * Pull from githubactions branch

    * Pull githubactions repo

    * Checkout githubactions

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Run tests individually

    * Pin plotly version

    * Run all tests even if one fails

    * Test on another branch

    * Switch branch with token

    * Update integration_tests.yml

    * Introduce pandas sorting in CRISPRessoCompare (#47)

    * New makefile commands

    * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

    * Extract out split_interleaved_fastq function to CRISPRessoShared

    * Implement splitting interleaved fastq files in CRISPRessoPooled

    * Suppress split_interleaved_input from CRISPRessoWGS parameters

    * Suppress other parameters in CRISPRessoWGS

    * Move where interleaved fastq files are split to be trimmed properly

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * On push no branches

    * On push no branches

    * All in one file

    * Fix yml errors

    * Rename jobs

    * Remove old workflow files

    * Remove paths

    * Run jobs in parallel

    ---------

    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * 3.4->2.08

    * Put ttf-mscorefonts-installer back above apt-get clean

    * restore slash, replace fastp with trimmomatic and flash, add autoremove step

    ---------

    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Guardrails clean history (#34)

    * Include guardrail functions

    * Add CRISPRessoReports subtree

    * Refactor to use CRISPRessoReports module

    * Include guardrail functions

    * Functional guardrails, needs reports update

    * Add guardrail partial

    * fix guardrials partial

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * GitHub actions integration tests (#48)

    * GitHub actions clean (#40)

    * Create pytest.yml

    * Create pylint.yml

    * Create .pylintrc

    * Create test_env.yml

    * Full path

    * Remove conda install

    * Replace path

    * Pytest tests

    * pip -e

    * Create integration_tests.yml

    * Simplify name

    * CRISPRESSO2_DIR environment variable

    * Up one dir

    * ls workspace

    * Install CRISPResso and ydiff

    * Clone repo instead of checkout

    * submodule

    * ls

    * CRISPResso2_copy

    * ls

    * Update env

    * Simplify

    * Pull from githubactions branch

    * Pull githubactions repo

    * Checkout githubactions

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Run tests individually

    * Pin plotly version

    * Run all tests even if one fails

    * Test on another branch

    * Switch branch with token

    * Update integration_tests.yml

    * Introduce pandas sorting in CRISPRessoCompare (#47)

    * New makefile commands

    * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

    * Extract out split_interleaved_fastq function to CRISPRessoShared

    * Implement splitting interleaved fastq files in CRISPRessoPooled

    * Suppress split_interleaved_input from CRISPRessoWGS parameters

    * Suppress other parameters in CRISPRessoWGS

    * Move where interleaved fastq files are split to be trimmed properly

    * Bug Fix - 367 (#35)

    * - Fixed references to ref_names_for_pe

    * removed extra tabs

    * trying to match empty line, no tabs

    * - changed references to ref_names[0]

    * Mckay/pd warnings (#45)

    * refactor errors='ignore' to try except

    * refactored integer slice to iloc[]

    * moved to_numeric try except to function

    * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

    This change is slightly cleaner because it addresses the root issue that some
    columns are strings (and can therefore not be converted to numeric types). Now
    if an error does occur when converting the dfs to numeric types it won't be
    swallowed up.

    * Add documentation to to_numeric_ignore_columns

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * On push no branches

    * On push no branches

    * All in one file

    * Fix yml errors

    * Rename jobs

    * Remove old workflow files

    * Remove paths

    * Run jobs in parallel

    ---------

    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: Cole Lyman <cole@colelyman.com>

    * Update C cythonized files

    * Add exact numbers to guardrails printouts

    * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

    * Fix calculation of `total_mods` from being negative

    The issue was that `all_deletion_coordinates` just tells you how many deletions
    were present, but not how long the deletion is.

    * Changes to message

    * Remove old tag

    * Point tests at guardrails

    * Restore C2 pro check

    * Save message with guardrail name

    * Point tests repo at master

    ---------

    Co-authored-by: Cole Lyman <cole@colelyman.com>
    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    ---------

    Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
    Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
    Co-authored-by: trevormartinj7 <trevormartinj7@gmail.com>

    * Batch d3 clean (#55)

    * imports C2Pro plots if available

    * added --use_matplotlib flag

    * added C2Pro
    matched api funciton signatures

    * added api args for plotly

    * added **kwargs

    * renamed config to custom_config, more specificity

    * added backend flag for plotly kaleido

    * added pro_installed boolean for templates, added plotly dependency to report templates

    * Squashed commit of the following:

    commit c909ea3b34e87ce637e00dac075d2bb2f8bfb954
    Author: McKay <mbowcut@gmail.com>
    Date:   Thu Feb 15 15:55:23 2024 -0700

        added plotly dependency for pro

    commit 76b3601f6a0144f100266153f1c999e0c5de65de
    Author: Samuel Nichols <Snic9004@gmail.com>
    Date:   Fri Jan 12 09:56:19 2024 -0700

        Squashed commit of the following:

        commit 603f2eff9d1aa21ae95f3e134da303b8018d3a33
        Author: Samuel Nichols <Snic9004@gmail.com>
        Date:   Fri Jan 12 09:48:20 2024 -0700

            fix guardrials partial

        commit 22fc03183a8070c30dfb74d5c23575ac19019855
        Author: Samuel Nichols <Snic9004@gmail.com>
        Date:   Fri Jan 12 08:54:01 2024 -0700

            Add guardrail partial

        commit e55f6b21972b578261bc5a864ce1d653d98f9e34
        Author: Samuel Nichols <Snic9004@gmail.com>
        Date:   Mon Jan 8 07:50:59 2024 -0700

            Functional guardrails, needs reports update

        commit 6e968e9699ed59a47d88191d03768e042d8b60a4
        Merge: 32b49685 e948ce10
        Author: Samuel Nichols <Snic9004@gmail.com>
        Date:   Mon Dec 18 13:34:36 2023 -0700

            Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history

        commit 32b49685da320501dad2b0ebbb57887b66220ba8
        Author: Samuel Nichols <Snic9004@gmail.com>
        Date:   Fri Dec 15 15:27:04 2023 -0700

            Include guardrail functions

        commit 4e309cf6f732565d635de3d4c5d074ada3027e2d
        Author: Cole Lyman <cole@colelyman.com>
        Date:   Mon Dec 18 10:51:55 2023 -0700

            Refactor to use CRISPRessoReports module

        commit e648dc087c0055bc5d2fca13c64071a371dea941
        Author: Cole Lyman <cole@colelyman.com>
        Date:   Mon Dec 18 10:51:11 2023 -0700

            Add CRISPRessoReports subtree

        commit e948ce107ebb0d1d99010ed12e937f34b5e607d4
        Author: Samuel Nichols <Snic9004@gmail.com>
        Date:   Fri Dec 15 15:27:04 2023 -0700

            Include guardrail functions

        commit d33c748871a625facfe8d792e29c77ab9779138f
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Nov 7 16:31:06 2023 -0700

            Include parameter --assign_ambiguous_alignments_to_first_reference in readme

        commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Wed Oct 11 17:17:30 2023 -0600

            Enable quantification by sgRNA (#348)

            This PR includes:
            - storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs']
            - a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately.

            I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command:

            ```

            CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table  -n hdr3 -p max -gn guide1,guide2
            ```

            ```
            python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3
            ```

            This produces:
            ```
            Processed 25000 alleles
            Reference: Reference (2391/23415 modified reads)
                    UNMODIFIED: 21024
                    MODIFIED guide1: 2359
                    MODIFIED guide2: 32
            Reference: HDR (856/1577 modified reads)
                    UNMODIFIED: 721
                    MODIFIED guide1: 854
                    MODIFIED guide1 + guide2: 1
                    MODIFIED guide2: 1
             ```

        commit 2e3da02fdbed2fa8ae02a277763d65a502459827
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Tue Oct 10 15:29:08 2023 -0600

            changed tuple to list for matplotlib change (#31) (#346)

            Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

        commit cd3c332135fe4db0f9218e3d87263d5c65838ed9
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Sun Oct 1 01:54:46 2023 -0600

            rename script to camel case

        commit 7c719d65fb36ac7654db9040f226564ea28fcab9
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Sun Oct 1 01:53:44 2023 -0600

            Add new script for counting high quality bases

        commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu Sep 14 15:15:30 2023 -0600

            Prime editing alignment params (#336)

            Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty.

            CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences.

            The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs.

        commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu Sep 7 16:43:30 2023 -0600

            Fix samtools piping (#325)

            * Remove samtools pipe stderr to stdout

            Sometimes some of the libraries that samtools depends on don't have the correct
            version information, and as such samtools will report this to stderr when run.
            Because we pipe the output of samtools, we expect it to be valid SAM format, but
            when these library version messages are reported, it breaks CRISPRessoWGS.

            * Remove extra spacing at end of lines and add missing comma in WGS

            * Log stderr from samtools in CRISPRessoWGS

        commit 8feff4101f27406d9d88ace97d31a518276bff3f
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Fri Sep 1 09:43:56 2023 -0600

            Replace link to CRISPResso schematic with raw URL in README (#329)

            * Replace link to CRISPResso schematic with raw URL

            * Add new lines to the beginning of unordered lists

        commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu Aug 10 00:52:12 2023 -0600

            Try to unbreak CircleCI

        commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu Aug 10 00:17:27 2023 -0600

            Center command line text messages

        commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu Aug 10 00:17:07 2023 -0600

            Fix bug in prime-editing scaffold-incorporation plotting

            If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read.

        commit 2b36a1a5c35e8a93516ce8baf464595615e0f402
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Wed Aug 9 15:29:48 2023 -0600

            CRISPRessoPooled --compile_postrun_references bug fixes

        commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Aug 8 23:30:15 2023 -0600

            Fix missing ' in Pooled --demultiplex_only_at_amplicons

        commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Mon Jul 24 10:47:46 2023 -0600

            Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316)

            * Make sorting stable

            * Including c files

            * Sort by #Reads instead of %Reads to avoid floating point errors

            ---------

            Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        commit de05533b3511a84f3b6b14fc2ef64db041613261
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu Jul 6 13:54:45 2023 -0600

            Fix multiprocessing lambda pickling (#311)

            * Fix running plots in parallel

            The reason the plots were running slower before this change is because I was
            calling the plot function, not passing it to `submit`. So it was essentially
            running in serial, but worse because it was still spinning up/down the
            processes.

            * Fix multiprocessing lambda pickling (#20)

            * Refactor process_futures to be a dict

            This makes debugging much easier because you can associate the arguments to the
            future with the results.

            * Fix the pickling error when running in multiprocessing

            Only top-level functions (not lambdas) can be pickled to use in multiprocessing
            pools, thus the lambdas are converted to a regular function.

            * Further fixes to pickling multiprocessing error (#21)

            * Refactor process_futures to be a dict

            This makes debugging much easier because you can associate the arguments to the
            future with the results.

            * Fix the pickling error when running in multiprocessing

            Only top-level functions (not lambdas) can be pickled to use in multiprocessing
            pools, thus the lambdas are converted to a regular function.

            * Use Counter instead of defaultdict in CRISPRessoCORE

            * Update process_futures to dict in Batch and Aggregate

        commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Jul 3 17:12:09 2023 -0600

            Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append

        commit 7285da0e987b77b72c8885bb35940e0f50c146bd
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Fri Jun 23 16:50:33 2023 -0600

            Fix print bug for invalid fastq

        commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c
        Author: kclem <k.clement.dev@gmail.com>
        Date:   Wed Jun 21 16:03:48 2023 -0600

            Slugify before creating filename - replaces invalid characters in batch names with _

        commit f97e29c67de4c80b8d6b9cf334f363be4b514ade
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Wed Jun 21 14:43:43 2023 -0600

            Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307)

            * Add verbosity argument to CRISPRessoAggregate (#18)

            * Allow for amplicon and guide seqs to be some variant of NA in batch (#19)

            This was discovered when attempting to infer amplicon sequences in batch mode on
            the web interface, NAs were supplied for the amplicon sequences to the sub
            CRISPResso commands.

        commit 32e1e9797da5c3033cdc588e92f06b8813961953
        Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu>
        Date:   Wed Jun 21 14:01:00 2023 -0600

            Allow for interrogation of overlapping sgRNA sites

        commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Jun 12 12:16:47 2023 -0600

            Check input fastq file format

            Asserts input format of fastq files - including if gzipped files are missing the gz suffix.

        commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Jun 5 13:41:55 2023 -0600

            Fix CRISPRessoArgParser

        commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Jun 5 13:29:31 2023 -0600

            Cosmetic updates for command-line use

            - version bump to 2.2.13
            - If no args are provided, the command line version will print out an abbreviated help message
            - parameters can be excluded from CRISPRessoArgParser

        commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu May 11 14:31:47 2023 -0600

            Fix multiprocessing error, don't start pool when only using single thread (#302)

            * Update README to have consistent use of `--base_editor_output` (#16)

            * Add files via upload

            * Only start process pools when using multiple processes

            This is mainly to solve the issue when running on AWS Lambda, but this should
            improve single core performance overall.

            ---------

            Co-authored-by: Kendell Clement <k.clement.dev@gmail.com>

        commit 92a705c939b370373a70cf6ae9f1616de33288b9
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu May 11 14:31:06 2023 -0600

            Update `base_editor` parameters in README and add Plot Harness (#301)

            * Update README to have consistent use of `--base_editor_output` (#16)

            * Add files via upload

            ---------

            Co-authored-by: Kendell Clement <k.clement.dev@gmail.com>

        commit 7d46c4490235df45c5546b1b470e4e6a99727031
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Wed May 10 15:41:33 2023 -0600

            Clarify CRISPRessoWGS intended use (#303)

            * Update README to have consistent use of `--base_editor_output` (#16)

            * Add sample plotting jupyter notebook

            * Add clarifying info to CRISPRessoWGS description

            Clarify WGS usage

        commit 833a701787bb47674b3e921c38cac6189c775cf7
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu May 4 17:02:46 2023 -0400

            Remove debug print statements

        commit 712eb2a11825e8d36f2870deb12b35486bd633fb
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu May 4 16:40:07 2023 -0400

            Allow dashes in filenames resolve #73

        commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Sat Apr 22 23:41:58 2023 -0400

            Raise exceptions from within futures in plot_pool

        commit 7e807a60de2a9d18bccd034b87106ceaf7153338
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Sat Apr 22 23:38:56 2023 -0400

            Fix future pandas indexing warning

            Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead"

        commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu Apr 20 13:59:27 2023 -0600

            Remove debug print statements fixes #295 (#297)

            The format string option used here is only available in Python version >=3.8.

        commit 478c06f784603e96d20f96e91993fdcc4ac35c8a
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu Apr 13 12:09:26 2023 -0400

            Update plotCustomAllelePlot.py script for #292 (#293)

            Update type of 'max_rows' param to int
            Fix location of 'args' in crispresso2_info object

        commit bcdae39e05d530f4a4e78738c3b30f7664981919
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Mar 27 13:18:34 2023 -0400

            Update pooled parameter format

        commit 546446e36e7e68b527767d6c31ec341a49df2059
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Feb 14 16:26:23 2023 -0500

            Fix running plots in parallel (#286)

            The reason the plots were running slower before this change is because I was
            calling the plot function, not passing it to `submit`. So it was essentially
            running in serial, but worse because it was still spinning up/down the
            processes.

            Co-authored-by: Cole Lyman <cole@colelyman.com>

        commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1
        Author: kclem <k.clement.dev@gmail.com>
        Date:   Fri Feb 10 15:45:15 2023 -0500

            Fix #283 to avoid filename collisions

            Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29

        commit e577318006cd17b2725bd028e5e56634c6eb829a
        Author: kclem <k.clement.dev@gmail.com>
        Date:   Mon Feb 6 16:37:25 2023 -0500

            Case-insensitive headers accepted in CRISPRessoPooled

        commit d34927620a4a6126a9988b3041e76f60728abbfe
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Jan 31 13:48:33 2023 -0500

            Fix print statement in CORE

        commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Jan 31 13:22:51 2023 -0500

            Version bump to 2.2.12

        commit 1d4679c72d0c8b4154317c9aff5179217198e2d7
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Jan 31 13:01:31 2023 -0500

            Status Updates + Pooled Mixed Mode Update (#279)

            * Implement logging handler to overwrite the latest log status to file

            * Add StatusHandler to CRISPRessoCORE log

            This will take the latest log output and write it to a file (`status.txt`), the
            catch being that with each log the file is overwritten so that one can easily
            tell where CRISPResso currently is and what the error is (if any). These changes
            include some slight refactoring in order to accomodate any potential parameter
            exceptions.

            * Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn`

            * Add StatusHandler to CRISPRessoPooled and a little refactoring

            * Implement `percent_complete` to the status log

            * Add StatusHandler to CRISPRessoAggregate log

            * Add StatusHandler to CRISPRessoCompare log

            * Add StatusHandler to CRISPRessoPooledWGSCompare log

            * Add StatusHandler to CRISPRessoWGS log

            * Rename `status.txt` to `CRISPResso_status.txt`

            * Modify status log names to match the tool they are generated from

            * Add percent_complete stages to CRISPRessoCORE

            These also include log statements of each plot that is being generated as well
            as fixing some variable name collisions with `ind`.

            * Format the percentage in the log to be 2 decimal places

            * Change all plotting logs from `info` to `debug` and simplify progress

            This refactors how the progress of the plots is calculated, making it much
            simplier. Before this change we would of had to keep track of the number of
            times `percent_complete` was output, but now it simply updates the percent
            complete after each amplicon is finished processing. Hopefully this will make
            things easier to mantain even though it will be a little less "accurate" (not
            sure how accurate the original implementation was...).

            * Implemented shared console log handler across all CRISPResso* calls

            This allows for easy changes to logging formatting, which was inspired by having
            to change the default logging level. The default logging level needs to be set
            at `logging.DEBUG` in order for the debug log statements to not be ignored for
            the running and status logs.

            * Add ability to set the verbosity level to each CRISPResso* tool

            This allows users to set a verbosity level between 1 and 4 using the
            `-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the
            level will default to 4, being the most verbose.

            * Implement showing the last seen `percent_compelte` when none is provided

            * Keep track of and log when multiple parallel runs are completed

            These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that
            we can now display when a run is completed. This potentially breaks how
            signals and interupts are handled with multiple runs happening, but this needs
            to be reviewed.

            * Add debug and percentage complete to CRISPRessoBatch

            * Add percent complete to CRISPRessoPooled

            * Add debug and percent_complete message to CRISPRessoAggregate

            * Add `percent_complete` to CRISPRessoCompare

            * Add `percent_complete` to CRISPRessoPooledWGSCompare

            * Add status and `percent_complete` to CRISPRessoMeta

            * Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare

            * Fixing documentation to match pooled headers

            * Header removal bug fix change documentation to guide_seq

            * Update documentation and help feature for CRISPRessoPooled

            * Remove extra newlines from CRISPRessoPooled -h

            * Make variable names as clear as my firstborn child's name

            * Update one more variable name

            * Fix bug to flow CRISPRessoPooled options to sub command

            * Make amplicon file args variable name clear

            * Update how parameters are set and retrieved from parameter object

            The refactor in the previous commit changed the type of the arguments to a
            dictionary which doesn't have the parameters as attributes, and this commit
            fixes that error.

            * Add note in output header for change in default CRISPRessoPooled

            In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the
            default when running in mixed-mode. This is to allow for inexact alignments of
            the reads and the amplicons to the genome. For more context, see this issue
            https://github.com/pinellolab/CRISPResso2/issues/276

            * Clarify the verbosity parameter help message

            * Separate out parameters to `normalize_name` in CRISPRessoCORE

            * Separate out parameters to `normalize_name` in CRISPRessoWGS

            * Separate out parameters to `normalize_name` in CRISPRessoPooled

            * Separate out parameters to `normalize_name` in CRISPRessoCompare

            * Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name`

            * Refactor `run_crispresso_cmds` to not require a `logger`

            This commit implements the functionality to make the `logger` object optional by
            seeing which module called the `run_crispresso_cmds` function and obtaining the
            correct object from that module name.

            The function also immediately returns when no commands are passed to it.

            * Add amplicon name to plotting debug statements in CRISPRessoCORE

            ---------

            Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>
            Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local>
            Co-authored-by: Cole Lyman <cole@colelyman.com>
            Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu Jan 26 15:27:27 2023 -0500

            CRISPRessoPooled custom header fix (#278)

            * Fixing documentation to match pooled headers

            * Header removal bug fix change documentation to guide_seq

            * Update documentation and help feature for CRISPRessoPooled

            * Remove extra newlines from CRISPRessoPooled -h

            * Make variable names as clear as my firstborn child's name

            * Update one more variable name

            Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        commit 104866e1080c973bb025d1a5ba59b19dca1658af
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu Jan 5 14:00:26 2023 -0700

            Fix deprecated numpy type names (fixes #269) (#270)

            In the most recent version of numpy (1.24) some of the types have been
            deprecated. This commit fixes these errors.

        commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu Jan 5 06:49:35 2023 -0700

            Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274)

            I have suffered enough trying to debug my installation, so hopefully this helps
            someone else.

            Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>

        commit b9851e98104602eb78c2b384105267624295e9d3
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu Dec 22 13:30:23 2022 -0700

            Fix bug when pooled bam is input (#265)

            This change checks to see if a bam file was input, and if so it doesn't try to
            remove any intermediate files because there aren't any.

            Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>

        commit b822612642043e75a19042941f69b457ce51f517
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Dec 19 15:26:45 2022 -0500

            Delete vscode settings

        commit b99aa624dec68ef7d19264340ce0cafa829625f4
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Dec 19 13:29:14 2022 -0500

            Clarify input param help for pooled bam

        commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Dec 19 13:28:54 2022 -0500

            Fix #235 - Cigar string is * if read unaligned

            Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235.

        commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Thu Dec 8 13:48:17 2022 -0700

            Add deprecation notice (#260)

            * Add FLASh and Trimmomatic deprecation notice to CLI output

            * Add Edilytics email address to CLI output

        commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Dec 6 12:16:19 2022 -0500

            Format filterReadsOnSequencePresence script

        commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Fri Dec 2 22:12:54 2022 -0500

            Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string

        commit 9ddea40f7f02b546941ddaa4c71fc5283075051a
        Author: kclem <k.clement.dev@gmail.com>
        Date:   Mon Nov 14 10:33:04 2022 -0500

            Add check for prime editing extension sequence in prime edited sequence

            if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence.

        commit 152f2dd5001da7090641ee8a1326bde9f7e8104e
        Author: kclem <k.clement.dev@gmail.com>
        Date:   Wed Nov 9 11:53:41 2022 -0500

            Version bump to 2.2.11a

        commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d
        Author: kclem <k.clement.dev@gmail.com>
        Date:   Wed Nov 9 11:47:30 2022 -0500

            Add param to override prime editing sequence checks

            CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.'

        commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b
        Author: kclem <k.clement.dev@gmail.com>
        Date:   Wed Nov 9 10:06:51 2022 -0500

            Update filterReadsOnSequencePresence.py

        commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Nov 7 22:25:16 2022 -0500

            Add script to filter input based on sequence presence

        commit 713e57a19c35180035ca35e11a5820065eda0198
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Oct 18 16:02:26 2022 -0400

            Allow spaces in read names for CRISPRessoWGS

        commit 39ce008bdddccdd8229c0ba185dce78bc2f66968
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Sat Oct 8 21:09:58 2022 -0600

            Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250)

        commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Sat Oct 8 23:08:47 2022 -0400

            Batch amplicon plots (#251)

            * Error out if HDR amplicon matches existing amplicon

            * Add check for amplicon sequence uniqueness

            * Fix bug with bam_input not having bam_output

            * Test for no returned lines in auto mode, version bump to 2.2.11

            * Fix pandas deprecation of df.append

        commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu Oct 6 16:32:02 2022 -0400

            Fix CRISPRessoBatch plot pool bug when plots are suppressed

        commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Wed Sep 21 21:04:51 2022 -0600

            Fix batch quilt plot name (#249)

            This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch.

        commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Thu Sep 15 15:49:08 2022 -0400

            Version bump to 2.2.10

        commit c5f79aebfc1ae209f4ee320df250eed89a02787c
        Author: Cole Lyman <Cole@colelyman.com>
        Date:   Wed Sep 14 14:24:55 2022 -0600

            Parallel plot refactor (#247)

            * Fix duplicate plotting in CRISPRessoBatch aggregate

            * Refactor mulltiprocessing plots in CRISPRessoBatch

            * Refactor multiprocessing plots in CRISPRessoCORE

            * Refactor multiprocessing plots for CRISPRessoAggregate

        commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Tue Sep 13 14:12:11 2022 -0400

            print files in curr dir if Aggregate can't find files

        commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0
        Author: Kendell Clement <k.clement.dev@gmail.com>
        Date:   Mon Sep 12 10:32:57 2022 -0400

            Spelling typo

        commit c15f01c75083403f17c58c121b2afe97e9f2a1ec
   …
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Jun 19, 2024
* Change CRISPResso_status.txt format to JSON (#46)

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* add json read for status file

* changed Formatter to json format

* fixed json access variable name: message

* changed  perentage_complete to numeric

* changed status file to .json

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* New makefile commands

* changed file to .json

* changed status to json file

* Make JSON human readable by adding new lines

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Move read filtering to after merging in CRISPResso (#39)

* Move read filtering to after merging

This is in an effort to be consistent with the behavior and results of
CRISPRessoPooled.

* Properly assign the correct file names for read filtering

* Add space around operators

* GitHub actions on pr (#51)

* Run integration tests on pull_request

* Run pytest on pull_request

* Run pylint on pull_request

* Run tests on PR only when opening PR (#53)

* Update reports (#52)

* Update report changes

* Switch branch of integration test repo

* Remove extraneous `crispresso_data_path`

* Point integration tests back to master

* point to test branch

* pointed CI config to testing branch

* Update integration_tests.yml

point to master

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

* Trevor/fastp integration (#50)

* Update check_program to check versions and create check_fastq function

* Update fastq arg, implement fastp in get_most_frequent_reads

* Bump version to 2.3.0

* Deprecate Flash and Trimmomatic parameters, and update fastp params

* Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

* Implement trimming of single end reads

* Merge (and trim) reads in CRISPRessoCORE with fastp

* Modify error handling to account for fastp errors

* Replace flash and trimmomatic with fastp in Docker dependencies

* Update LICENSE.txt with fastp info

* Remove min and max amplicon length (no longer needed)

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Implement trimming with fastp in CRISPRessoPooled

* Implemend merging (and trimming) with fastp in CRISPRessoPooled

* Fixed minor fastp errors

* Move read filtering to after merging in CRISPResso (#39)

* Move read filtering to after merging

This is in an effort to be consistent with the behavior and results of
CRISPRessoPooled.

* Properly assign the correct file names for read filtering

* Add space around operators

* GitHub actions on pr (#51)

* Run integration tests on pull_request

* Run pytest on pull_request

* Run pylint on pull_request

* Run tests on PR only when opening PR (#53)

* Update reports (#52)

* Update report changes

* Switch branch of integration test repo

* Remove extraneous `crispresso_data_path`

* Point integration tests back to master

* Update where the test point to

* Fix 'Prime-edited' key not found (#32)

* Move 'Prime-edited' amplicon name check

By moving this, it will check if there is an amplicon named
'Prime-edited' (which is a reserved name) even if the
`prime_editing_pegRNA_extension_seq` parameter is empty.

* Only search for scaffold integration when pegRNA extension seq is provided

* Remove spaces at the end of lines

* Docker size (#49)

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* 3.4->2.08

* Put ttf-mscorefonts-installer back above apt-get clean

* restore slash, replace fastp with trimmomatic and flash, add autoremove step

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* initial readme modifications

* Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

* Pointing test branch back at master

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

* Guardrails clean history (#34)

* Include guardrail functions

* Add CRISPRessoReports subtree

* Refactor to use CRISPRessoReports module

* Include guardrail functions

* Functional guardrails, needs reports update

* Add guardrail partial

* fix guardrials partial

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Update C cythonized files

* Add exact numbers to guardrails printouts

* Remove extraneous whitespace from CRISPRessoCOREResources.pyx

* Fix calculation of `total_mods` from being negative

The issue was that `all_deletion_coordinates` just tells you how many deletions
were present, but not how long the deletion is.

* Changes to message

* Remove old tag

* Point tests at guardrails

* Restore C2 pro check

* Save message with guardrail name

* Point tests repo at master

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

* Fix case sensitivity in Prime Editing mode (#54)

* Move read filtering to after merging in CRISPResso (#39)

* Move read filtering to after merging

This is in an effort to be consistent with the behavior and results of
CRISPRessoPooled.

* Properly assign the correct file names for read filtering

* Add space around operators

* GitHub actions on pr (#51)

* Run integration tests on pull_request

* Run pytest on pull_request

* Run pylint on pull_request

* Run tests on PR only when opening PR (#53)

* Update reports (#52)

* Update report changes

* Switch branch of integration test repo

* Remove extraneous `crispresso_data_path`

* Point integration tests back to master

* Make all amplicons in amplicon_seq_arr uppercase

This fixes https://github.com/pinellolab/CRISPResso2/issues/396

* Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

* Fix 'Prime-edited' key not found (#32)

* Move 'Prime-edited' amplicon name check

By moving this, it will check if there is an amplicon named
'Prime-edited' (which is a reserved name) even if the
`prime_editing_pegRNA_extension_seq` parameter is empty.

* Only search for scaffold integration when pegRNA extension seq is provided

* Remove spaces at the end of lines

* Docker size (#49)

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* 3.4->2.08

* Put ttf-mscorefonts-installer back above apt-get clean

* restore slash, replace fastp with trimmomatic and flash, add autoremove step

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Guardrails clean history (#34)

* Include guardrail functions

* Add CRISPRessoReports subtree

* Refactor to use CRISPRessoReports module

* Include guardrail functions

* Functional guardrails, needs reports update

* Add guardrail partial

* fix guardrials partial

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* GitHub actions integration tests (#48)

* GitHub actions clean (#40)

* Create pytest.yml

* Create pylint.yml

* Create .pylintrc

* Create test_env.yml

* Full path

* Remove conda install

* Replace path

* Pytest tests

* pip -e

* Create integration_tests.yml

* Simplify name

* CRISPRESSO2_DIR environment variable

* Up one dir

* ls workspace

* Install CRISPResso and ydiff

* Clone repo instead of checkout

* submodule

* ls

* CRISPResso2_copy

* ls

* Update env

* Simplify

* Pull from githubactions branch

* Pull githubactions repo

* Checkout githubactions

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Run tests individually

* Pin plotly version

* Run all tests even if one fails

* Test on another branch

* Switch branch with token

* Update integration_tests.yml

* Introduce pandas sorting in CRISPRessoCompare (#47)

* New makefile commands

* Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

* Extract out split_interleaved_fastq function to CRISPRessoShared

* Implement splitting interleaved fastq files in CRISPRessoPooled

* Suppress split_interleaved_input from CRISPRessoWGS parameters

* Suppress other parameters in CRISPRessoWGS

* Move where interleaved fastq files are split to be trimmed properly

* Bug Fix - 367 (#35)

* - Fixed references to ref_names_for_pe

* removed extra tabs

* trying to match empty line, no tabs

* - changed references to ref_names[0]

* Mckay/pd warnings (#45)

* refactor errors='ignore' to try except

* refactored integer slice to iloc[]

* moved to_numeric try except to function

* Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

This change is slightly cleaner because it addresses the root issue that some
columns are strings (and can therefore not be converted to numeric types). Now
if an error does occur when converting the dfs to numeric types it won't be
swallowed up.

* Add documentation to to_numeric_ignore_columns

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* On push no branches

* On push no branches

* All in one file

* Fix yml errors

* Rename jobs

* Remove old workflow files

* Remove paths

* Run jobs in parallel

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Update C cythonized files

* Add exact numbers to guardrails printouts

* Remove extraneous whitespace from CRISPRessoCOREResources.pyx

* Fix calculation of `total_mods` from being negative

The issue was that `all_deletion_coordinates` just tells you how many deletions
were present, but not how long the deletion is.

* Changes to message

* Remove old tag

* Point tests at guardrails

* Restore C2 pro check

* Save message with guardrail name

* Point tests repo at master

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

---------

Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: trevormartinj7 <trevormartinj7@gmail.com>

* Batch d3 clean (#55)

* imports C2Pro plots if available

* added --use_matplotlib flag

* added C2Pro
matched api funciton signatures

* added api args for plotly

* added **kwargs

* renamed config to custom_config, more specificity

* added backend flag for plotly kaleido

* added pro_installed boolean for templates, added plotly dependency to report templates

* Squashed commit of the following:

commit c909ea3b34e87ce637e00dac075d2bb2f8bfb954
Author: McKay <mbowcut@gmail.com>
Date:   Thu Feb 15 15:55:23 2024 -0700

    added plotly dependency for pro

commit 76b3601f6a0144f100266153f1c999e0c5de65de
Author: Samuel Nichols <Snic9004@gmail.com>
Date:   Fri Jan 12 09:56:19 2024 -0700

    Squashed commit of the following:

    commit 603f2eff9d1aa21ae95f3e134da303b8018d3a33
    Author: Samuel Nichols <Snic9004@gmail.com>
    Date:   Fri Jan 12 09:48:20 2024 -0700

        fix guardrials partial

    commit 22fc03183a8070c30dfb74d5c23575ac19019855
    Author: Samuel Nichols <Snic9004@gmail.com>
    Date:   Fri Jan 12 08:54:01 2024 -0700

        Add guardrail partial

    commit e55f6b21972b578261bc5a864ce1d653d98f9e34
    Author: Samuel Nichols <Snic9004@gmail.com>
    Date:   Mon Jan 8 07:50:59 2024 -0700

        Functional guardrails, needs reports update

    commit 6e968e9699ed59a47d88191d03768e042d8b60a4
    Merge: 32b49685 e948ce10
    Author: Samuel Nichols <Snic9004@gmail.com>
    Date:   Mon Dec 18 13:34:36 2023 -0700

        Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history

    commit 32b49685da320501dad2b0ebbb57887b66220ba8
    Author: Samuel Nichols <Snic9004@gmail.com>
    Date:   Fri Dec 15 15:27:04 2023 -0700

        Include guardrail functions

    commit 4e309cf6f732565d635de3d4c5d074ada3027e2d
    Author: Cole Lyman <cole@colelyman.com>
    Date:   Mon Dec 18 10:51:55 2023 -0700

        Refactor to use CRISPRessoReports module

    commit e648dc087c0055bc5d2fca13c64071a371dea941
    Author: Cole Lyman <cole@colelyman.com>
    Date:   Mon Dec 18 10:51:11 2023 -0700

        Add CRISPRessoReports subtree

    commit e948ce107ebb0d1d99010ed12e937f34b5e607d4
    Author: Samuel Nichols <Snic9004@gmail.com>
    Date:   Fri Dec 15 15:27:04 2023 -0700

        Include guardrail functions

    commit d33c748871a625facfe8d792e29c77ab9779138f
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Nov 7 16:31:06 2023 -0700

        Include parameter --assign_ambiguous_alignments_to_first_reference in readme

    commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Oct 11 17:17:30 2023 -0600

        Enable quantification by sgRNA (#348)

        This PR includes:
        - storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs']
        - a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately.

        I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command:

        ```

        CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table  -n hdr3 -p max -gn guide1,guide2
        ```

        ```
        python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3
        ```

        This produces:
        ```
        Processed 25000 alleles
        Reference: Reference (2391/23415 modified reads)
                UNMODIFIED: 21024
                MODIFIED guide1: 2359
                MODIFIED guide2: 32
        Reference: HDR (856/1577 modified reads)
                UNMODIFIED: 721
                MODIFIED guide1: 854
                MODIFIED guide1 + guide2: 1
                MODIFIED guide2: 1
         ```

    commit 2e3da02fdbed2fa8ae02a277763d65a502459827
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Oct 10 15:29:08 2023 -0600

        changed tuple to list for matplotlib change (#31) (#346)

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit cd3c332135fe4db0f9218e3d87263d5c65838ed9
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Sun Oct 1 01:54:46 2023 -0600

        rename script to camel case

    commit 7c719d65fb36ac7654db9040f226564ea28fcab9
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Sun Oct 1 01:53:44 2023 -0600

        Add new script for counting high quality bases

    commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Sep 14 15:15:30 2023 -0600

        Prime editing alignment params (#336)

        Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty.

        CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences.

        The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs.

    commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Sep 7 16:43:30 2023 -0600

        Fix samtools piping (#325)

        * Remove samtools pipe stderr to stdout

        Sometimes some of the libraries that samtools depends on don't have the correct
        version information, and as such samtools will report this to stderr when run.
        Because we pipe the output of samtools, we expect it to be valid SAM format, but
        when these library version messages are reported, it breaks CRISPRessoWGS.

        * Remove extra spacing at end of lines and add missing comma in WGS

        * Log stderr from samtools in CRISPRessoWGS

    commit 8feff4101f27406d9d88ace97d31a518276bff3f
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Sep 1 09:43:56 2023 -0600

        Replace link to CRISPResso schematic with raw URL in README (#329)

        * Replace link to CRISPResso schematic with raw URL

        * Add new lines to the beginning of unordered lists

    commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Aug 10 00:52:12 2023 -0600

        Try to unbreak CircleCI

    commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Aug 10 00:17:27 2023 -0600

        Center command line text messages

    commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Aug 10 00:17:07 2023 -0600

        Fix bug in prime-editing scaffold-incorporation plotting

        If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read.

    commit 2b36a1a5c35e8a93516ce8baf464595615e0f402
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Aug 9 15:29:48 2023 -0600

        CRISPRessoPooled --compile_postrun_references bug fixes

    commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Aug 8 23:30:15 2023 -0600

        Fix missing ' in Pooled --demultiplex_only_at_amplicons

    commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon Jul 24 10:47:46 2023 -0600

        Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316)

        * Make sorting stable

        * Including c files

        * Sort by #Reads instead of %Reads to avoid floating point errors

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    commit de05533b3511a84f3b6b14fc2ef64db041613261
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Jul 6 13:54:45 2023 -0600

        Fix multiprocessing lambda pickling (#311)

        * Fix running plots in parallel

        The reason the plots were running slower before this change is because I was
        calling the plot function, not passing it to `submit`. So it was essentially
        running in serial, but worse because it was still spinning up/down the
        processes.

        * Fix multiprocessing lambda pickling (#20)

        * Refactor process_futures to be a dict

        This makes debugging much easier because you can associate the arguments to the
        future with the results.

        * Fix the pickling error when running in multiprocessing

        Only top-level functions (not lambdas) can be pickled to use in multiprocessing
        pools, thus the lambdas are converted to a regular function.

        * Further fixes to pickling multiprocessing error (#21)

        * Refactor process_futures to be a dict

        This makes debugging much easier because you can associate the arguments to the
        future with the results.

        * Fix the pickling error when running in multiprocessing

        Only top-level functions (not lambdas) can be pickled to use in multiprocessing
        pools, thus the lambdas are converted to a regular function.

        * Use Counter instead of defaultdict in CRISPRessoCORE

        * Update process_futures to dict in Batch and Aggregate

    commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Jul 3 17:12:09 2023 -0600

        Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append

    commit 7285da0e987b77b72c8885bb35940e0f50c146bd
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Fri Jun 23 16:50:33 2023 -0600

        Fix print bug for invalid fastq

    commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Wed Jun 21 16:03:48 2023 -0600

        Slugify before creating filename - replaces invalid characters in batch names with _

    commit f97e29c67de4c80b8d6b9cf334f363be4b514ade
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed Jun 21 14:43:43 2023 -0600

        Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307)

        * Add verbosity argument to CRISPRessoAggregate (#18)

        * Allow for amplicon and guide seqs to be some variant of NA in batch (#19)

        This was discovered when attempting to infer amplicon sequences in batch mode on
        the web interface, NAs were supplied for the amplicon sequences to the sub
        CRISPResso commands.

    commit 32e1e9797da5c3033cdc588e92f06b8813961953
    Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu>
    Date:   Wed Jun 21 14:01:00 2023 -0600

        Allow for interrogation of overlapping sgRNA sites

    commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Jun 12 12:16:47 2023 -0600

        Check input fastq file format

        Asserts input format of fastq files - including if gzipped files are missing the gz suffix.

    commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Jun 5 13:41:55 2023 -0600

        Fix CRISPRessoArgParser

    commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Jun 5 13:29:31 2023 -0600

        Cosmetic updates for command-line use

        - version bump to 2.2.13
        - If no args are provided, the command line version will print out an abbreviated help message
        - parameters can be excluded from CRISPRessoArgParser

    commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu May 11 14:31:47 2023 -0600

        Fix multiprocessing error, don't start pool when only using single thread (#302)

        * Update README to have consistent use of `--base_editor_output` (#16)

        * Add files via upload

        * Only start process pools when using multiple processes

        This is mainly to solve the issue when running on AWS Lambda, but this should
        improve single core performance overall.

        ---------

        Co-authored-by: Kendell Clement <k.clement.dev@gmail.com>

    commit 92a705c939b370373a70cf6ae9f1616de33288b9
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu May 11 14:31:06 2023 -0600

        Update `base_editor` parameters in README and add Plot Harness (#301)

        * Update README to have consistent use of `--base_editor_output` (#16)

        * Add files via upload

        ---------

        Co-authored-by: Kendell Clement <k.clement.dev@gmail.com>

    commit 7d46c4490235df45c5546b1b470e4e6a99727031
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 10 15:41:33 2023 -0600

        Clarify CRISPRessoWGS intended use (#303)

        * Update README to have consistent use of `--base_editor_output` (#16)

        * Add sample plotting jupyter notebook

        * Add clarifying info to CRISPRessoWGS description

        Clarify WGS usage

    commit 833a701787bb47674b3e921c38cac6189c775cf7
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 4 17:02:46 2023 -0400

        Remove debug print statements

    commit 712eb2a11825e8d36f2870deb12b35486bd633fb
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 4 16:40:07 2023 -0400

        Allow dashes in filenames resolve #73

    commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Sat Apr 22 23:41:58 2023 -0400

        Raise exceptions from within futures in plot_pool

    commit 7e807a60de2a9d18bccd034b87106ceaf7153338
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Sat Apr 22 23:38:56 2023 -0400

        Fix future pandas indexing warning

        Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead"

    commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 20 13:59:27 2023 -0600

        Remove debug print statements fixes #295 (#297)

        The format string option used here is only available in Python version >=3.8.

    commit 478c06f784603e96d20f96e91993fdcc4ac35c8a
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Apr 13 12:09:26 2023 -0400

        Update plotCustomAllelePlot.py script for #292 (#293)

        Update type of 'max_rows' param to int
        Fix location of 'args' in crispresso2_info object

    commit bcdae39e05d530f4a4e78738c3b30f7664981919
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Mar 27 13:18:34 2023 -0400

        Update pooled parameter format

    commit 546446e36e7e68b527767d6c31ec341a49df2059
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Feb 14 16:26:23 2023 -0500

        Fix running plots in parallel (#286)

        The reason the plots were running slower before this change is because I was
        calling the plot function, not passing it to `submit`. So it was essentially
        running in serial, but worse because it was still spinning up/down the
        processes.

        Co-authored-by: Cole Lyman <cole@colelyman.com>

    commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Fri Feb 10 15:45:15 2023 -0500

        Fix #283 to avoid filename collisions

        Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29

    commit e577318006cd17b2725bd028e5e56634c6eb829a
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Mon Feb 6 16:37:25 2023 -0500

        Case-insensitive headers accepted in CRISPRessoPooled

    commit d34927620a4a6126a9988b3041e76f60728abbfe
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Jan 31 13:48:33 2023 -0500

        Fix print statement in CORE

    commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Jan 31 13:22:51 2023 -0500

        Version bump to 2.2.12

    commit 1d4679c72d0c8b4154317c9aff5179217198e2d7
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Jan 31 13:01:31 2023 -0500

        Status Updates + Pooled Mixed Mode Update (#279)

        * Implement logging handler to overwrite the latest log status to file

        * Add StatusHandler to CRISPRessoCORE log

        This will take the latest log output and write it to a file (`status.txt`), the
        catch being that with each log the file is overwritten so that one can easily
        tell where CRISPResso currently is and what the error is (if any). These changes
        include some slight refactoring in order to accomodate any potential parameter
        exceptions.

        * Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn`

        * Add StatusHandler to CRISPRessoPooled and a little refactoring

        * Implement `percent_complete` to the status log

        * Add StatusHandler to CRISPRessoAggregate log

        * Add StatusHandler to CRISPRessoCompare log

        * Add StatusHandler to CRISPRessoPooledWGSCompare log

        * Add StatusHandler to CRISPRessoWGS log

        * Rename `status.txt` to `CRISPResso_status.txt`

        * Modify status log names to match the tool they are generated from

        * Add percent_complete stages to CRISPRessoCORE

        These also include log statements of each plot that is being generated as well
        as fixing some variable name collisions with `ind`.

        * Format the percentage in the log to be 2 decimal places

        * Change all plotting logs from `info` to `debug` and simplify progress

        This refactors how the progress of the plots is calculated, making it much
        simplier. Before this change we would of had to keep track of the number of
        times `percent_complete` was output, but now it simply updates the percent
        complete after each amplicon is finished processing. Hopefully this will make
        things easier to mantain even though it will be a little less "accurate" (not
        sure how accurate the original implementation was...).

        * Implemented shared console log handler across all CRISPResso* calls

        This allows for easy changes to logging formatting, which was inspired by having
        to change the default logging level. The default logging level needs to be set
        at `logging.DEBUG` in order for the debug log statements to not be ignored for
        the running and status logs.

        * Add ability to set the verbosity level to each CRISPResso* tool

        This allows users to set a verbosity level between 1 and 4 using the
        `-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the
        level will default to 4, being the most verbose.

        * Implement showing the last seen `percent_compelte` when none is provided

        * Keep track of and log when multiple parallel runs are completed

        These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that
        we can now display when a run is completed. This potentially breaks how
        signals and interupts are handled with multiple runs happening, but this needs
        to be reviewed.

        * Add debug and percentage complete to CRISPRessoBatch

        * Add percent complete to CRISPRessoPooled

        * Add debug and percent_complete message to CRISPRessoAggregate

        * Add `percent_complete` to CRISPRessoCompare

        * Add `percent_complete` to CRISPRessoPooledWGSCompare

        * Add status and `percent_complete` to CRISPRessoMeta

        * Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare

        * Fixing documentation to match pooled headers

        * Header removal bug fix change documentation to guide_seq

        * Update documentation and help feature for CRISPRessoPooled

        * Remove extra newlines from CRISPRessoPooled -h

        * Make variable names as clear as my firstborn child's name

        * Update one more variable name

        * Fix bug to flow CRISPRessoPooled options to sub command

        * Make amplicon file args variable name clear

        * Update how parameters are set and retrieved from parameter object

        The refactor in the previous commit changed the type of the arguments to a
        dictionary which doesn't have the parameters as attributes, and this commit
        fixes that error.

        * Add note in output header for change in default CRISPRessoPooled

        In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the
        default when running in mixed-mode. This is to allow for inexact alignments of
        the reads and the amplicons to the genome. For more context, see this issue
        https://github.com/pinellolab/CRISPResso2/issues/276

        * Clarify the verbosity parameter help message

        * Separate out parameters to `normalize_name` in CRISPRessoCORE

        * Separate out parameters to `normalize_name` in CRISPRessoWGS

        * Separate out parameters to `normalize_name` in CRISPRessoPooled

        * Separate out parameters to `normalize_name` in CRISPRessoCompare

        * Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name`

        * Refactor `run_crispresso_cmds` to not require a `logger`

        This commit implements the functionality to make the `logger` object optional by
        seeing which module called the `run_crispresso_cmds` function and obtaining the
        correct object from that module name.

        The function also immediately returns when no commands are passed to it.

        * Add amplicon name to plotting debug statements in CRISPRessoCORE

        ---------

        Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>
        Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local>
        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jan 26 15:27:27 2023 -0500

        CRISPRessoPooled custom header fix (#278)

        * Fixing documentation to match pooled headers

        * Header removal bug fix change documentation to guide_seq

        * Update documentation and help feature for CRISPRessoPooled

        * Remove extra newlines from CRISPRessoPooled -h

        * Make variable names as clear as my firstborn child's name

        * Update one more variable name

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    commit 104866e1080c973bb025d1a5ba59b19dca1658af
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Jan 5 14:00:26 2023 -0700

        Fix deprecated numpy type names (fixes #269) (#270)

        In the most recent version of numpy (1.24) some of the types have been
        deprecated. This commit fixes these errors.

    commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Jan 5 06:49:35 2023 -0700

        Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274)

        I have suffered enough trying to debug my installation, so hopefully this helps
        someone else.

        Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>

    commit b9851e98104602eb78c2b384105267624295e9d3
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Dec 22 13:30:23 2022 -0700

        Fix bug when pooled bam is input (#265)

        This change checks to see if a bam file was input, and if so it doesn't try to
        remove any intermediate files because there aren't any.

        Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>

    commit b822612642043e75a19042941f69b457ce51f517
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Dec 19 15:26:45 2022 -0500

        Delete vscode settings

    commit b99aa624dec68ef7d19264340ce0cafa829625f4
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Dec 19 13:29:14 2022 -0500

        Clarify input param help for pooled bam

    commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Dec 19 13:28:54 2022 -0500

        Fix #235 - Cigar string is * if read unaligned

        Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235.

    commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Dec 8 13:48:17 2022 -0700

        Add deprecation notice (#260)

        * Add FLASh and Trimmomatic deprecation notice to CLI output

        * Add Edilytics email address to CLI output

    commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Dec 6 12:16:19 2022 -0500

        Format filterReadsOnSequencePresence script

    commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Fri Dec 2 22:12:54 2022 -0500

        Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string

    commit 9ddea40f7f02b546941ddaa4c71fc5283075051a
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Mon Nov 14 10:33:04 2022 -0500

        Add check for prime editing extension sequence in prime edited sequence

        if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence.

    commit 152f2dd5001da7090641ee8a1326bde9f7e8104e
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Wed Nov 9 11:53:41 2022 -0500

        Version bump to 2.2.11a

    commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Wed Nov 9 11:47:30 2022 -0500

        Add param to override prime editing sequence checks

        CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.'

    commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Wed Nov 9 10:06:51 2022 -0500

        Update filterReadsOnSequencePresence.py

    commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Nov 7 22:25:16 2022 -0500

        Add script to filter input based on sequence presence

    commit 713e57a19c35180035ca35e11a5820065eda0198
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Oct 18 16:02:26 2022 -0400

        Allow spaces in read names for CRISPRessoWGS

    commit 39ce008bdddccdd8229c0ba185dce78bc2f66968
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Sat Oct 8 21:09:58 2022 -0600

        Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250)

    commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Sat Oct 8 23:08:47 2022 -0400

        Batch amplicon plots (#251)

        * Error out if HDR amplicon matches existing amplicon

        * Add check for amplicon sequence uniqueness

        * Fix bug with bam_input not having bam_output

        * Test for no returned lines in auto mode, version bump to 2.2.11

        * Fix pandas deprecation of df.append

    commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Oct 6 16:32:02 2022 -0400

        Fix CRISPRessoBatch plot pool bug when plots are suppressed

    commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed Sep 21 21:04:51 2022 -0600

        Fix batch quilt plot name (#249)

        This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch.

    commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Sep 15 15:49:08 2022 -0400

        Version bump to 2.2.10

    commit c5f79aebfc1ae209f4ee320df250eed89a02787c
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed Sep 14 14:24:55 2022 -0600

        Parallel plot refactor (#247)

        * Fix duplicate plotting in CRISPRessoBatch aggregate

        * Refactor mulltiprocessing plots in CRISPRessoBatch

        * Refactor multiprocessing plots in CRISPRessoCORE

        * Refactor multiprocessing plots for CRISPRessoAggregate

    commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Sep 13 14:12:11 2022 -0400

        print files in curr dir if Aggregate can't find files

    commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Sep 12 10:32:57 2022 -0400

        Spelling typo

    commit c15f01c75083403f17c58c121b2afe97e9f2a1ec
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue Sep 6 17:49:52 2022 -0400

        Add helper function to create alignment scoring matrix

        New scoring matrix can be created using CRISPResso2Align.make_matrix()

    commit c80f82838c5a228b79ad4484092877cfee08e02c
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon Aug 22 18:28:33 2022 -0600

        Add `zip_output` (#240)

        * Making zip of results

        * Zip command added, if zip is true place_report_in_output_folder is also true, zip removes all files while zipping

        * Adding --zip to compare and pooled/wgs compare

        * Add more formatting changes to CRISPRessoShared

        * Refactoring propagate_crispress_options so only one version exists

        * Zip added to arguments_to_ignore and warning added when changing arguments

        * Restore styling

        * Update README to include --zip

        * Rename --zip to --zip_output

        * Change --zip to --zip_output in CompareCORE and PooledWGSCompareCORE

        * Bug fix arg to args

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    commit 5de3d7286d8e33c7cf4d3615fce715806e72f511
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Aug 11 21:42:34 2022 -0400

        Fix fix to aggregate for CRISPRessoWGS

    commit a2294c266f43b14969a5d6474076f31a77a57173
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Aug 11 21:40:50 2022 -0400

        Fix bug in aggregate for WGS

    commit 7ce3eb4abe4b8ceac933272ac9cb16a8bedf26a3
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Aug 8 21:53:45 2022 -0400

        Update CRISPRessoWGS to allow non-word characters in region names

    commit 040ac0033d6e250f4e3a412101874cf5e914e08a
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Mon Aug 8 16:04:59 2022 -0400

        Enable processing of cram files by CRISPRessoWGS

        Adds --reference to samtools view when viewing cram files

    commit cf112a0caba8789e28530cc09171285ec6ea9b4c
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Mon Aug 8 14:55:46 2022 -0400

        Auto amplicon detection for interleaved input

        Enables processing of interleaved fastq files for guess_guides and guess_amplicons, as well as get_most_frequent_reads. When interleaved input is present, the input is first separated into R1/R2 files, then processing is performed.

    commit 4ba524dc7b947feca8a0f743837844f9febc2171
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Aug 4 11:32:11 2022 -0600

        Potential fix for aggregate plots in Batch mode (#237)

    commit 6097a8a104d3f156ef7c08e196ac37e32bf04c71
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 21 22:45:48 2022 -0400

        Fix pct_vectors in crispresso2_info json object

    commit 65a079d86d6f386793397398f839c46014b54543
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Jul 20 23:46:37 2022 -0400

        Fix more readme spelling bugs

    commit e817376ecd54cdea1f29e303ca25b9e7d1d38333
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Jul 20 23:42:23 2022 -0400

        Fix bug in readme spelling

    commit 49740ba1d66ed6d13a9e154b8b17bc8b5186581d
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Jul 20 16:10:09 2022 -0400

        Fix loading of crispresso info from WGS and Pooled

    commit b68a43271115251b18e8955e285ccc18f549e8cd
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 14 14:11:04 2022 -0400

        Add plotly to dockerfile

    commit b0b7d41d697304d0d5fc93e3346c9de1b98ba41d
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 14 14:10:00 2022 -0400

        Fix #231 Allow N's in bam output (Try 2)

    commit c460b3e73fd06a230dbac2e37c86b833144ebf94
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 14 14:09:10 2022 -0400

        Revert "Fix #231 Allow N's in bam output"

        This reverts commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3.

    commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 14 13:52:37 2022 -0400

        Fix #231 Allow N's in bam output

    commit 0a2419e518dc9b3520058c3927f98b31cd51347e
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Jul 8 21:10:01 2022 -0600

        Fix bug when name is provided instead of amplicon_name in pooled input file (#229)

        Also, raise an exception (instead of incorrectly executing) when there are not
        enough matched parameters in the pooled input file.

    commit cb58212379803788c04ca5793baaa760cbbeaa81
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Jul 8 21:09:49 2022 -0600

        Fix bug when comparing two samples with the same name. (#228)

    commit e8a796f5f451409cbafed4404dfba4b6b8a124ca
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jun 23 21:30:23 2022 -0400

        Version bump to 2.2.9

    commit 632143ddedea48bab9229baeb4bf3ea4d1f658d6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon Jun 20 19:53:14 2022 -0600

        Don't run global frameshift plot when there are no reads (#226)

        When there are no reads (i.e. global_MODIFIED_FRAMESHIFT +
        global_MODIFIED_NON_FRAMESHIFT + global_NON_MODIFIED_NON_FRAMESHIFT == 0) there
        was a bug when trying to compute the pie chart, because all of the values in the
        pie chart are 0. This fix, will make sure that there is at least one read in
        order for the plot to bee constructed properly.

    commit 4bb06218e835d2624d53fd401542caef6f8a3a55
    Author: kclem <k.clement.dev@gmail.com>
    Date:   Fri Jun 3 16:57:02 2022 -0400

        Improvements for guide inference in 'auto' mode

        In 'auto' mode, a putative guide sequence is selected at the site of maximal editing.  If the site of maximal editing happens near the end of the guide (e.g. base 0) many things will break (e.g. quantification windows, etc). This update excludes bases from being used to find the guide using the --exclude_bp_from_left and --exclude_bp_from_right parameters. At default, these parameters are 15bp, so the first and last 15bp would not be selected for the site of maximal editing and thus be the site of a guide sequence. In addition, the site of maximal editing must have 3x the magnitude over the background.

    commit 9d64de187835b2553ad2b4374d32edab27f83645
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jun 2 20:22:25 2022 -0400

        Update README.md

    commit 6aafc5387986f5089ba55b68d128343d68052792
    Author: Simon P Shen <sshen8@users.noreply.github.com>
    Date:   Tue May 31 17:42:53 2022 -0400

        directory in quotes in batch cmd (#222)

        Add quotes around output folder for folders that have spaces.

    commit 432f163ac68b9a650d1fd326171aadc505ee87f4
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Tue May 24 23:38:36 2022 -0400

        CRISPRessoBatch fills NA values in batch settings

 …
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Jul 31, 2024
commit 71dd12786fec6c4aba0170a3bfd9022b06f5eede
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Wed Jul 31 14:10:29 2024 -0600

    Squashed commit of the following:

    commit 5e3b30515c4bc437127e7fb21f53cb0bd511c4ca
    Author: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
    Date:   Mon Jul 22 09:31:44 2024 -0600

        D3-Enhancements (#78)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Provide sgRNA_sequences to plot_nucleotide_quilt plots

        * Passing sgRNA_sequences to plot

        * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

        * Add max-height to Batch report samples

        * Change testing branch

        * Fix wrong check for large Batch plots

        * Fix typo and move flexiguide to debug (#77)

        * Change flexiguide output to debug level

        * Fix typo in fastp merged output file name

        * Adding id tags for d3 script enhancements

        * pointing to test branch

        * Add amplicon_name parameter to allele heatmap and line plots

        * Add function to extract quantification window regions from include_idxs

        * Scale the quantification window according to the coordinates of the sgRNA plot

        * added c2pro check, added space in args.json

        * Correct the quantification window indexes for multiple guides

        * Fix name of nucleotide conversion plot when guides are not the same

        * Fix jinja variables that aren't found

        * Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

        * Remove unneeded variable and extra whitespace

        * Switch test branch to master

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

    commit 09e5d9720ad21e44fc7916d71bde3fd7a9dfa7ef
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 18 14:31:54 2024 -0600

        Asymmetrical cut point (#457)

        * add cut_point_ind to plot_alleles_heatmap for asymmetrical plotting

        * Cole asymmetrical cut point (#453)

        * Pin versions of numpy and matplotlib in CI environment (#84) (#452)

        * Reduce duplication and implement cut_point_ind in plot_alleles_heatmap_hist

        ---------

        Co-authored-by: Cole Lyman <Cole@colelyman.com>

    commit 8d92972694ddff629dad844a6ad100459f69751d
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Jul 18 14:29:40 2024 -0600

        Cole/update args (#85) (#456)

    commit 44f692ecabf5e2eb96ee0cfd7bae62343da7810c
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon Jul 15 16:17:29 2024 -0600

        Implement new pooled mixed-mode default behavior (#454)

        * changes for pooled mixed-mode default (#83)

        * changes for pooled mixed-mode default

        * deprecated old arg

        * added integration tests for mixed mode

        * fixed test target

        * updated test name

        * pinned numpy

        * Fix integration tests yml

        * pinning matplotlib

        * added print to CI tests

        * changed mixed mode info string

        * Remove pooled-mixed-mode-align-to-genome step from Github Actions

        * Update demultiplex_genome_wide parameter and help

        * Convert args.json to unix line endings

        * Add Pooled mixed mode demux run

        * Update the name of the argument in Pooled

        * Point integration tests back to master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Revert change to pooled mixed mode info statement (#86)

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 79b482b55a0e8edbc03ec22bd2714bade1e90323
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Jul 9 12:53:23 2024 -0600

        Pin versions of numpy and matplotlib in CI environment (#84) (#452)

    commit 80dc1bdd72d50f989717bfc5f8156bc3495c45f4
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 30 14:07:42 2024 -0600

        Add padding to image

    commit 381755daf0939aaf2745df0a802c809633aff47d
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 30 13:59:57 2024 -0600

        White background for schematic for dark mode

    commit d649db71e610bd8840fbb8d46fadb07789b67390
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri May 24 12:45:53 2024 -0600

        Fix typo and move flexiguide to debug (#77) (#438)

        * Change flexiguide output to debug level

        * Fix typo in fastp merged output file name

    commit 71181f50ef2b39015523b1a71d9fd1bf0dce14eb
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon May 13 13:34:00 2024 -0600

        Prefix the release Docker tag with a `v` (#434)

    commit d2c2be18a6bb64b0e742cc24c4665980a24324bc
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon May 13 09:41:32 2024 -0600

        Showing sgRNA sequences on hover in CRISPRessoPro (#432)

        * Passing sgRNA sequences to regular and Batch D3 plots (#73)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Provide sgRNA_sequences to plot_nucleotide_quilt plots

        * Passing sgRNA_sequences to plot

        * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

        * Add max-height to Batch report samples

        * Change testing branch

        * Fix wrong check for large Batch plots

        * Update integration_tests.yml to point back at master

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Push new releases to ECR (#74)

        * Create aws_ecr.yml (#1)

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * us-east-1

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Fix d3 sgRNA sequences (#76)

        * Pass correct sgRNA_sequences to d3 plot

        * Pass correct sgRNA sequence to prime editor plot for d3

        * Resize plotly (#75)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Pass div id for plotly

        * Remove debug

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 1c504274818b6b17fb60620d48fd92cb2e50566d
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu May 9 14:16:25 2024 -0600

        Fix plots and improve plot error handling (#431)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit acb2ea8e26dff4cd11f71301b344f81b1cec9040
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 2 13:49:33 2024 -0600

        Use recent docker image for CircleCI testing that includes updated pandas

    commit 38fd76dbd7ce2087468f9f454b548777de959a68
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 1 16:42:28 2024 -0600

        Cole/fix status file name (#69) (#430)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

    commit 3ec22e5fd09e432c9997d30e5f9ee51a2cc00d7b
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed May 1 13:08:11 2024 -0600

        Remove linked space in readme

    commit 340a4e16795a5e500411e11572ec267525985009
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 1 13:07:14 2024 -0600

        Fix batch mode pandas warning. (#70) (#429)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 1bc9e906f0ded81f80761d1ec375ee50a4f882a9
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Apr 26 16:26:27 2024 -0600

        Bump version to 2.3.1 and change default CRISPRessoPooled behavior to change in 2.3.2 (#428)

    commit 5638a1f6ffa973231f23422e9c757fa8cd4af7cc
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Apr 24 18:00:43 2024 -0600

        Spelling fixes

    commit d6011f29db16d8fc1c1e7222457b7f9a1f671de6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed Apr 24 09:33:53 2024 -0600

        Extract `jinja_partials` and fix CRISPRessoPooled fastp errors (#425)

        * Updated README (#64)

        * Updating README to fix argument, email, and formatting

        * removing superfluous files

        * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

        * Remove link to CRISPRessoPro

        * Replace Docker badge with link to tags

        * Add bullet points to Guardrails section and improve formatting

        * Fix typo and removed colons from guardrails

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Extract jinja_partials  (#65)

        * Extract jinja_partials code

        * Remove Plotly dependency from setup.py

        * Fix CRISPRessoPooled flash errors (#68)

        * Fix replacing flash intermediate files with fastp intermediate files

        This also moves where the files are added to `files_to_remove` up to
        near where they are created.

        * Update to run test branch with paired end Pooled test

        * Add pooled-paired-sim test to integration tests

        * Replace flash and trimmomatic with fastp and remove plotly from Github Actions environment

        * Change test branch back to master

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

    commit f4858a30c43374f54058b3ad9c1e965e1ab7fb46
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Apr 23 17:00:28 2024 -0600

        Updated README (#64) (#424)

        * Updating README to fix argument, email, and formatting

        * removing superfluous files

        * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

        * Remove link to CRISPRessoPro

        * Replace Docker badge with link to tags

        * Add bullet points to Guardrails section and improve formatting

        * Fix typo and removed colons from guardrails

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

    commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Apr 22 11:24:59 2024 -0600

        Update CRISPRessoPooledCORE.py (#423)

        Fix bug in error reporting if duplicate names are present

    commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 18 16:55:39 2024 -0600

        Remove extra imports from CRISPRessoCore (#67) (#422)

    commit 4aae57e5be475cd717792265bee36a71a99425de
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 18 10:00:19 2024 -0600

        Cole/refactor jinja undefined (#66) (#421)

        * Replace Jinja2 PackageLoader with FileSystemLoader

        The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
        and Python 3.9. Replacing with FileSystemLoader work with the older version and
        the latest version.

        * Fix undefined variable `amplicon_name` in report template

        * Refactor logging Jinja2 undefined variable warnings

        * Revert plot_11a update

        * Update intedration test branch

        * Update jinja to warn on undefined but not fail. Fix all undefined warnings

        * Fix github integration tests ref

        * One more undefined variable

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Apr 9 17:30:10 2024 -0600

        Fix Jinja2 undefined variables (#63) (#417)

        * Replace Jinja2 PackageLoader with FileSystemLoader

        The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
        and Python 3.9. Replacing with FileSystemLoader work with the older version and
        the latest version.

        * Fix undefined variable `amplicon_name` in report template

        * Revert plot_11a update

        * Update intedration test branch

        * Update branch for integration tests

    commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
    Author: Han Dai <github@daihan.me>
    Date:   Fri Apr 5 18:36:41 2024 -0400

        fix: change all U+00A0 to U+0020 (#400)

    commit 235dc29c0cd0fcca2e999148d4660acf00b07221
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Apr 5 16:36:16 2024 -0600

        Fastp, args as data, guardrails, and PE fix (#415)

        * Change CRISPResso_status.txt format to JSON (#46)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * add json read for status file

        * changed Formatter to json format

        * fixed json access variable name: message

        * changed  perentage_complete to numeric

        * changed status file to .json

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * New makefile commands

        * changed file to .json

        * changed status to json file

        * Make JSON human readable by adding new lines

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * point to test branch

        * pointed CI config to testing branch

        * Update integration_tests.yml

        point to master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        * Trevor/fastp integration (#50)

        * Update check_program to check versions and create check_fastq function

        * Update fastq arg, implement fastp in get_most_frequent_reads

        * Bump version to 2.3.0

        * Deprecate Flash and Trimmomatic parameters, and update fastp params

        * Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

        * Implement trimming of single end reads

        * Merge (and trim) reads in CRISPRessoCORE with fastp

        * Modify error handling to account for fastp errors

        * Replace flash and trimmomatic with fastp in Docker dependencies

        * Update LICENSE.txt with fastp info

        * Remove min and max amplicon length (no longer needed)

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Implement trimming with fastp in CRISPRessoPooled

        * Implemend merging (and trimming) with fastp in CRISPRessoPooled

        * Fixed minor fastp errors

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * Update where the test point to

        * Fix 'Prime-edited' key not found (#32)

        * Move 'Prime-edited' amplicon name check

        By moving this, it will check if there is an amplicon named
        'Prime-edited' (which is a reserved name) even if the
        `prime_editing_pegRNA_extension_seq` parameter is empty.

        * Only search for scaffold integration when pegRNA extension seq is provided

        * Remove spaces at the end of lines

        * Docker size (#49)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * 3.4->2.08

        * Put ttf-mscorefonts-installer back above apt-get clean

        * restore slash, replace fastp with trimmomatic and flash, add autoremove step

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * initial readme modifications

        * Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

        * Pointing test branch back at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        * Guardrails clean history (#34)

        * Include guardrail functions

        * Add CRISPRessoReports subtree

        * Refactor to use CRISPRessoReports module

        * Include guardrail functions

        * Functional guardrails, needs reports update

        * Add guardrail partial

        * fix guardrials partial

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Update C cythonized files

        * Add exact numbers to guardrails printouts

        * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

        * Fix calculation of `total_mods` from being negative

        The issue was that `all_deletion_coordinates` just tells you how many deletions
        were present, but not how long the deletion is.

        * Changes to message

        * Remove old tag

        * Point tests at guardrails

        * Restore C2 pro check

        * Save message with guardrail name

        * Point tests repo at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

        * Fix case sensitivity in Prime Editing mode (#54)

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * Make all amplicons in amplicon_seq_arr uppercase

        This fixes https://github.com/pinellolab/CRISPResso2/issues/396

        * Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

        * Fix 'Prime-edited' key not found (#32)

        * Move 'Prime-edited' amplicon name check

        By moving this, it will check if there is an amplicon named
        'Prime-edited' (which is a reserved name) even if the
        `prime_editing_pegRNA_extension_seq` parameter is empty.

        * Only search for scaffold integration when pegRNA extension seq is provided

        * Remove spaces at the end of lines

        * Docker size (#49)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * 3.4->2.08

        * Put ttf-mscorefonts-installer back above apt-get clean

        * restore slash, replace fastp with trimmomatic and flash, add autoremove step

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Guardrails clean history (#34)

        * Include guardrail functions

        * Add CRISPRessoReports subtree

        * Refactor to use CRISPRessoReports module

        * Include guardrail functions

        * Functional guardrails, needs reports update

        * Add guardrail partial

        * fix guardrials partial

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Update C cythonized files

        * Add exact numbers to guardrails printouts

        * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

        * Fix calculation of `total_mods` from being negative

        The issue was that `all_deletion_coordinates` just tells you how many deletions
        were present, but not how long the deletion is.

        * Changes to message

        * Remove old tag

        * Point tests at guardrails

        * Restore C2 pro check

        * Save message with guardrail name

        * Point tests repo at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: trevormartinj7 <trevormartinj7@gmail.com>

        * Batch d3 clean (#55)

        * imports C2Pro plots if available

        * added --use_matplotlib flag

        * added C2Pro
        matched api funciton signatures

        * added api args for plotly

        * added **kwargs

        * renamed config to custom_config, more specificity

        * added backend flag for plotly kaleido

        * added pro_installed boolean for templates, added plotly dependency to report templates

        * Squashed commit of the following:

        commit c909ea3b34e87ce637e00dac075d2bb2f8bfb954
        Author: McKay <mbow…
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Aug 16, 2024
commit 6ec98a05ee70f85b5aa0ac15ab6094b7f1f20d08
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Tue Aug 13 16:44:39 2024 -0600

    dict key changes

commit 7cfd5acf06da4eb6f49453144ee1fed1e1488a7a
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Thu Aug 8 15:30:31 2024 -0600

    added C2PRO install check back

commit bfb0003329ea61b5c79c7e1df8d9a73ec5a508db
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Fri Aug 2 13:08:12 2024 -0600

    fixed key error conditionals

commit 84444e7480605206cb3efa4a0db675c55e717304
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Fri Aug 2 09:22:44 2024 -0600

    use local jinja_paritals file

commit 71dd12786fec6c4aba0170a3bfd9022b06f5eede
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Wed Jul 31 14:10:29 2024 -0600

    Squashed commit of the following:

    commit 5e3b30515c4bc437127e7fb21f53cb0bd511c4ca
    Author: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
    Date:   Mon Jul 22 09:31:44 2024 -0600

        D3-Enhancements (#78)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Provide sgRNA_sequences to plot_nucleotide_quilt plots

        * Passing sgRNA_sequences to plot

        * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

        * Add max-height to Batch report samples

        * Change testing branch

        * Fix wrong check for large Batch plots

        * Fix typo and move flexiguide to debug (#77)

        * Change flexiguide output to debug level

        * Fix typo in fastp merged output file name

        * Adding id tags for d3 script enhancements

        * pointing to test branch

        * Add amplicon_name parameter to allele heatmap and line plots

        * Add function to extract quantification window regions from include_idxs

        * Scale the quantification window according to the coordinates of the sgRNA plot

        * added c2pro check, added space in args.json

        * Correct the quantification window indexes for multiple guides

        * Fix name of nucleotide conversion plot when guides are not the same

        * Fix jinja variables that aren't found

        * Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

        * Remove unneeded variable and extra whitespace

        * Switch test branch to master

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

    commit 09e5d9720ad21e44fc7916d71bde3fd7a9dfa7ef
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 18 14:31:54 2024 -0600

        Asymmetrical cut point (#457)

        * add cut_point_ind to plot_alleles_heatmap for asymmetrical plotting

        * Cole asymmetrical cut point (#453)

        * Pin versions of numpy and matplotlib in CI environment (#84) (#452)

        * Reduce duplication and implement cut_point_ind in plot_alleles_heatmap_hist

        ---------

        Co-authored-by: Cole Lyman <Cole@colelyman.com>

    commit 8d92972694ddff629dad844a6ad100459f69751d
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Jul 18 14:29:40 2024 -0600

        Cole/update args (#85) (#456)

    commit 44f692ecabf5e2eb96ee0cfd7bae62343da7810c
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon Jul 15 16:17:29 2024 -0600

        Implement new pooled mixed-mode default behavior (#454)

        * changes for pooled mixed-mode default (#83)

        * changes for pooled mixed-mode default

        * deprecated old arg

        * added integration tests for mixed mode

        * fixed test target

        * updated test name

        * pinned numpy

        * Fix integration tests yml

        * pinning matplotlib

        * added print to CI tests

        * changed mixed mode info string

        * Remove pooled-mixed-mode-align-to-genome step from Github Actions

        * Update demultiplex_genome_wide parameter and help

        * Convert args.json to unix line endings

        * Add Pooled mixed mode demux run

        * Update the name of the argument in Pooled

        * Point integration tests back to master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Revert change to pooled mixed mode info statement (#86)

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 79b482b55a0e8edbc03ec22bd2714bade1e90323
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Jul 9 12:53:23 2024 -0600

        Pin versions of numpy and matplotlib in CI environment (#84) (#452)

    commit 80dc1bdd72d50f989717bfc5f8156bc3495c45f4
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 30 14:07:42 2024 -0600

        Add padding to image

    commit 381755daf0939aaf2745df0a802c809633aff47d
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 30 13:59:57 2024 -0600

        White background for schematic for dark mode

    commit d649db71e610bd8840fbb8d46fadb07789b67390
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri May 24 12:45:53 2024 -0600

        Fix typo and move flexiguide to debug (#77) (#438)

        * Change flexiguide output to debug level

        * Fix typo in fastp merged output file name

    commit 71181f50ef2b39015523b1a71d9fd1bf0dce14eb
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon May 13 13:34:00 2024 -0600

        Prefix the release Docker tag with a `v` (#434)

    commit d2c2be18a6bb64b0e742cc24c4665980a24324bc
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon May 13 09:41:32 2024 -0600

        Showing sgRNA sequences on hover in CRISPRessoPro (#432)

        * Passing sgRNA sequences to regular and Batch D3 plots (#73)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Provide sgRNA_sequences to plot_nucleotide_quilt plots

        * Passing sgRNA_sequences to plot

        * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

        * Add max-height to Batch report samples

        * Change testing branch

        * Fix wrong check for large Batch plots

        * Update integration_tests.yml to point back at master

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Push new releases to ECR (#74)

        * Create aws_ecr.yml (#1)

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * us-east-1

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Fix d3 sgRNA sequences (#76)

        * Pass correct sgRNA_sequences to d3 plot

        * Pass correct sgRNA sequence to prime editor plot for d3

        * Resize plotly (#75)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Pass div id for plotly

        * Remove debug

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 1c504274818b6b17fb60620d48fd92cb2e50566d
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu May 9 14:16:25 2024 -0600

        Fix plots and improve plot error handling (#431)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit acb2ea8e26dff4cd11f71301b344f81b1cec9040
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 2 13:49:33 2024 -0600

        Use recent docker image for CircleCI testing that includes updated pandas

    commit 38fd76dbd7ce2087468f9f454b548777de959a68
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 1 16:42:28 2024 -0600

        Cole/fix status file name (#69) (#430)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

    commit 3ec22e5fd09e432c9997d30e5f9ee51a2cc00d7b
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed May 1 13:08:11 2024 -0600

        Remove linked space in readme

    commit 340a4e16795a5e500411e11572ec267525985009
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 1 13:07:14 2024 -0600

        Fix batch mode pandas warning. (#70) (#429)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 1bc9e906f0ded81f80761d1ec375ee50a4f882a9
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Apr 26 16:26:27 2024 -0600

        Bump version to 2.3.1 and change default CRISPRessoPooled behavior to change in 2.3.2 (#428)

    commit 5638a1f6ffa973231f23422e9c757fa8cd4af7cc
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Apr 24 18:00:43 2024 -0600

        Spelling fixes

    commit d6011f29db16d8fc1c1e7222457b7f9a1f671de6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed Apr 24 09:33:53 2024 -0600

        Extract `jinja_partials` and fix CRISPRessoPooled fastp errors (#425)

        * Updated README (#64)

        * Updating README to fix argument, email, and formatting

        * removing superfluous files

        * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

        * Remove link to CRISPRessoPro

        * Replace Docker badge with link to tags

        * Add bullet points to Guardrails section and improve formatting

        * Fix typo and removed colons from guardrails

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Extract jinja_partials  (#65)

        * Extract jinja_partials code

        * Remove Plotly dependency from setup.py

        * Fix CRISPRessoPooled flash errors (#68)

        * Fix replacing flash intermediate files with fastp intermediate files

        This also moves where the files are added to `files_to_remove` up to
        near where they are created.

        * Update to run test branch with paired end Pooled test

        * Add pooled-paired-sim test to integration tests

        * Replace flash and trimmomatic with fastp and remove plotly from Github Actions environment

        * Change test branch back to master

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

    commit f4858a30c43374f54058b3ad9c1e965e1ab7fb46
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Apr 23 17:00:28 2024 -0600

        Updated README (#64) (#424)

        * Updating README to fix argument, email, and formatting

        * removing superfluous files

        * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

        * Remove link to CRISPRessoPro

        * Replace Docker badge with link to tags

        * Add bullet points to Guardrails section and improve formatting

        * Fix typo and removed colons from guardrails

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

    commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Apr 22 11:24:59 2024 -0600

        Update CRISPRessoPooledCORE.py (#423)

        Fix bug in error reporting if duplicate names are present

    commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 18 16:55:39 2024 -0600

        Remove extra imports from CRISPRessoCore (#67) (#422)

    commit 4aae57e5be475cd717792265bee36a71a99425de
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 18 10:00:19 2024 -0600

        Cole/refactor jinja undefined (#66) (#421)

        * Replace Jinja2 PackageLoader with FileSystemLoader

        The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
        and Python 3.9. Replacing with FileSystemLoader work with the older version and
        the latest version.

        * Fix undefined variable `amplicon_name` in report template

        * Refactor logging Jinja2 undefined variable warnings

        * Revert plot_11a update

        * Update intedration test branch

        * Update jinja to warn on undefined but not fail. Fix all undefined warnings

        * Fix github integration tests ref

        * One more undefined variable

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Apr 9 17:30:10 2024 -0600

        Fix Jinja2 undefined variables (#63) (#417)

        * Replace Jinja2 PackageLoader with FileSystemLoader

        The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
        and Python 3.9. Replacing with FileSystemLoader work with the older version and
        the latest version.

        * Fix undefined variable `amplicon_name` in report template

        * Revert plot_11a update

        * Update intedration test branch

        * Update branch for integration tests

    commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
    Author: Han Dai <github@daihan.me>
    Date:   Fri Apr 5 18:36:41 2024 -0400

        fix: change all U+00A0 to U+0020 (#400)

    commit 235dc29c0cd0fcca2e999148d4660acf00b07221
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Apr 5 16:36:16 2024 -0600

        Fastp, args as data, guardrails, and PE fix (#415)

        * Change CRISPResso_status.txt format to JSON (#46)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * add json read for status file

        * changed Formatter to json format

        * fixed json access variable name: message

        * changed  perentage_complete to numeric

        * changed status file to .json

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * New makefile commands

        * changed file to .json

        * changed status to json file

        * Make JSON human readable by adding new lines

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * point to test branch

        * pointed CI config to testing branch

        * Update integration_tests.yml

        point to master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        * Trevor/fastp integration (#50)

        * Update check_program to check versions and create check_fastq function

        * Update fastq arg, implement fastp in get_most_frequent_reads

        * Bump version to 2.3.0

        * Deprecate Flash and Trimmomatic parameters, and update fastp params

        * Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

        * Implement trimming of single end reads

        * Merge (and trim) reads in CRISPRessoCORE with fastp

        * Modify error handling to account for fastp errors

        * Replace flash and trimmomatic with fastp in Docker dependencies

        * Update LICENSE.txt with fastp info

        * Remove min and max amplicon length (no longer needed)

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Implement trimming with fastp in CRISPRessoPooled

        * Implemend merging (and trimming) with fastp in CRISPRessoPooled

        * Fixed minor fastp errors

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * Update where the test point to

        * Fix 'Prime-edited' key not found (#32)

        * Move 'Prime-edited' amplicon name check

        By moving this, it will check if there is an amplicon named
        'Prime-edited' (which is a reserved name) even if the
        `prime_editing_pegRNA_extension_seq` parameter is empty.

        * Only search for scaffold integration when pegRNA extension seq is provided

        * Remove spaces at the end of lines

        * Docker size (#49)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * 3.4->2.08

        * Put ttf-mscorefonts-installer back above apt-get clean

        * restore slash, replace fastp with trimmomatic and flash, add autoremove step

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * initial readme modifications

        * Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

        * Pointing test branch back at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        * Guardrails clean history (#34)

        * Include guardrail functions

        * Add CRISPRessoReports subtree

        * Refactor to use CRISPRessoReports module

        * Include guardrail functions

        * Functional guardrails, needs reports update

        * Add guardrail partial

        * fix guardrials partial

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Update C cythonized files

        * Add exact numbers to guardrails printouts

        * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

        * Fix calculation of `total_mods` from being negative

        The issue was that `all_deletion_coordinates` just tells you how many deletions
        were present, but not how long the deletion is.

        * Changes to message

        * Remove old tag

        * Point tests at guardrails

        * Restore C2 pro check

        * Save message with guardrail name

        * Point tests repo at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

        * Fix case sensitivity in Prime Editing mode (#54)

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * Make all amplicons in amplicon_seq_arr uppercase

        This fixes https://github.com/pinellolab/CRISPResso2/issues/396

        * Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

        * Fix 'Prime-edited' key not found (#32)

        * Move 'Prime-edited' amplicon name check

        By moving this, it will check if there is an amplicon named
        'Prime-edited' (which is a reserved name) even if the
        `prime_editing_pegRNA_extension_seq` parameter is empty.

        * Only search for scaffold integration when pegRNA extension seq is provided

        * Remove spaces at the end of lines

        * Docker size (#49)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * 3.4->2.08

        * Put ttf-mscorefonts-installer back above apt-get clean

        * restore slash, replace fastp with trimmomatic and flash, add autoremove step

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Guardrails clean history (#34)

        * Include guardrail functions

        * Add CRISPRessoReports subtree

        * Refactor to use CRISPRessoReports module

        * Include guardrail functions

        * Functional guardrails, needs reports update

        * Add guardrail partial

        * fix guardrials partial

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Update C cythonized files

        * Add exact numbers to guardrails printouts

        * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

        * Fix calculation of `total_mods` from being negative

        The issue was that `all_deletion_coordinates` just tells you how many deletions
        were present, but not how long the deletion is.

        * Changes to message

        * Remove old tag

        * Point tests at guardrails

        * Restore C2 pro check

        * Save message with guardrail name

        * Point tests repo at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-…
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Aug 19, 2024
commit 354f962d4201ae4784108b0a89467796af6ec326
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:49:32 2024 -0600

    specify encoding

commit 823250b8108ede27b29d59d1239c74c93d74395f
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:46:17 2024 -0600

    changed _ROOT to _root

commit fb8cfa7614598f23e578b55b92ca9b685eef3156
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:44:32 2024 -0600

    added docstrings

commit e0777a805e4da9729118b429fb44687ecc15d590
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:32:34 2024 -0600

    fixes for linting

commit 3ade759b85992484ae59aa7db3f10fe8e6bbdc50
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:04:43 2024 -0600

    Squashed commit of the following:

    commit 42be4bb0bcd58cdf9c902a448a7e5bde888fb1d3
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Mon Aug 19 14:36:55 2024 -0600

        added pro check for plotly import in batchReport

    commit 31873d15fff9b9b12c1e8d8c62efa686c12cbd37
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Fri Aug 16 15:05:58 2024 -0600

        pointed integration tests at test branch

    commit d449600561074c8721322e94a8375b3ad742a88c
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Fri Aug 16 14:24:03 2024 -0600

        Squashed commit of the following:

        commit 6ec98a05ee70f85b5aa0ac15ab6094b7f1f20d08
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Tue Aug 13 16:44:39 2024 -0600

            dict key changes

        commit 7cfd5acf06da4eb6f49453144ee1fed1e1488a7a
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Thu Aug 8 15:30:31 2024 -0600

            added C2PRO install check back

        commit bfb0003329ea61b5c79c7e1df8d9a73ec5a508db
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Fri Aug 2 13:08:12 2024 -0600

            fixed key error conditionals

        commit 84444e7480605206cb3efa4a0db675c55e717304
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Fri Aug 2 09:22:44 2024 -0600

            use local jinja_paritals file

        commit 71dd12786fec6c4aba0170a3bfd9022b06f5eede
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Wed Jul 31 14:10:29 2024 -0600

            Squashed commit of the following:

            commit 5e3b30515c4bc437127e7fb21f53cb0bd511c4ca
            Author: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
            Date:   Mon Jul 22 09:31:44 2024 -0600

                D3-Enhancements (#78)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Provide sgRNA_sequences to plot_nucleotide_quilt plots

                * Passing sgRNA_sequences to plot

                * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

                * Add max-height to Batch report samples

                * Change testing branch

                * Fix wrong check for large Batch plots

                * Fix typo and move flexiguide to debug (#77)

                * Change flexiguide output to debug level

                * Fix typo in fastp merged output file name

                * Adding id tags for d3 script enhancements

                * pointing to test branch

                * Add amplicon_name parameter to allele heatmap and line plots

                * Add function to extract quantification window regions from include_idxs

                * Scale the quantification window according to the coordinates of the sgRNA plot

                * added c2pro check, added space in args.json

                * Correct the quantification window indexes for multiple guides

                * Fix name of nucleotide conversion plot when guides are not the same

                * Fix jinja variables that aren't found

                * Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

                * Remove unneeded variable and extra whitespace

                * Switch test branch to master

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

            commit 09e5d9720ad21e44fc7916d71bde3fd7a9dfa7ef
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu Jul 18 14:31:54 2024 -0600

                Asymmetrical cut point (#457)

                * add cut_point_ind to plot_alleles_heatmap for asymmetrical plotting

                * Cole asymmetrical cut point (#453)

                * Pin versions of numpy and matplotlib in CI environment (#84) (#452)

                * Reduce duplication and implement cut_point_ind in plot_alleles_heatmap_hist

                ---------

                Co-authored-by: Cole Lyman <Cole@colelyman.com>

            commit 8d92972694ddff629dad844a6ad100459f69751d
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Jul 18 14:29:40 2024 -0600

                Cole/update args (#85) (#456)

            commit 44f692ecabf5e2eb96ee0cfd7bae62343da7810c
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon Jul 15 16:17:29 2024 -0600

                Implement new pooled mixed-mode default behavior (#454)

                * changes for pooled mixed-mode default (#83)

                * changes for pooled mixed-mode default

                * deprecated old arg

                * added integration tests for mixed mode

                * fixed test target

                * updated test name

                * pinned numpy

                * Fix integration tests yml

                * pinning matplotlib

                * added print to CI tests

                * changed mixed mode info string

                * Remove pooled-mixed-mode-align-to-genome step from Github Actions

                * Update demultiplex_genome_wide parameter and help

                * Convert args.json to unix line endings

                * Add Pooled mixed mode demux run

                * Update the name of the argument in Pooled

                * Point integration tests back to master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Revert change to pooled mixed mode info statement (#86)

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 79b482b55a0e8edbc03ec22bd2714bade1e90323
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Jul 9 12:53:23 2024 -0600

                Pin versions of numpy and matplotlib in CI environment (#84) (#452)

            commit 80dc1bdd72d50f989717bfc5f8156bc3495c45f4
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 30 14:07:42 2024 -0600

                Add padding to image

            commit 381755daf0939aaf2745df0a802c809633aff47d
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 30 13:59:57 2024 -0600

                White background for schematic for dark mode

            commit d649db71e610bd8840fbb8d46fadb07789b67390
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri May 24 12:45:53 2024 -0600

                Fix typo and move flexiguide to debug (#77) (#438)

                * Change flexiguide output to debug level

                * Fix typo in fastp merged output file name

            commit 71181f50ef2b39015523b1a71d9fd1bf0dce14eb
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon May 13 13:34:00 2024 -0600

                Prefix the release Docker tag with a `v` (#434)

            commit d2c2be18a6bb64b0e742cc24c4665980a24324bc
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon May 13 09:41:32 2024 -0600

                Showing sgRNA sequences on hover in CRISPRessoPro (#432)

                * Passing sgRNA sequences to regular and Batch D3 plots (#73)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Provide sgRNA_sequences to plot_nucleotide_quilt plots

                * Passing sgRNA_sequences to plot

                * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

                * Add max-height to Batch report samples

                * Change testing branch

                * Fix wrong check for large Batch plots

                * Update integration_tests.yml to point back at master

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Push new releases to ECR (#74)

                * Create aws_ecr.yml (#1)

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * us-east-1

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Fix d3 sgRNA sequences (#76)

                * Pass correct sgRNA_sequences to d3 plot

                * Pass correct sgRNA sequence to prime editor plot for d3

                * Resize plotly (#75)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Pass div id for plotly

                * Remove debug

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 1c504274818b6b17fb60620d48fd92cb2e50566d
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu May 9 14:16:25 2024 -0600

                Fix plots and improve plot error handling (#431)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit acb2ea8e26dff4cd11f71301b344f81b1cec9040
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 2 13:49:33 2024 -0600

                Use recent docker image for CircleCI testing that includes updated pandas

            commit 38fd76dbd7ce2087468f9f454b548777de959a68
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed May 1 16:42:28 2024 -0600

                Cole/fix status file name (#69) (#430)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

            commit 3ec22e5fd09e432c9997d30e5f9ee51a2cc00d7b
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Wed May 1 13:08:11 2024 -0600

                Remove linked space in readme

            commit 340a4e16795a5e500411e11572ec267525985009
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed May 1 13:07:14 2024 -0600

                Fix batch mode pandas warning. (#70) (#429)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 1bc9e906f0ded81f80761d1ec375ee50a4f882a9
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri Apr 26 16:26:27 2024 -0600

                Bump version to 2.3.1 and change default CRISPRessoPooled behavior to change in 2.3.2 (#428)

            commit 5638a1f6ffa973231f23422e9c757fa8cd4af7cc
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Wed Apr 24 18:00:43 2024 -0600

                Spelling fixes

            commit d6011f29db16d8fc1c1e7222457b7f9a1f671de6
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed Apr 24 09:33:53 2024 -0600

                Extract `jinja_partials` and fix CRISPRessoPooled fastp errors (#425)

                * Updated README (#64)

                * Updating README to fix argument, email, and formatting

                * removing superfluous files

                * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

                * Remove link to CRISPRessoPro

                * Replace Docker badge with link to tags

                * Add bullet points to Guardrails section and improve formatting

                * Fix typo and removed colons from guardrails

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Extract jinja_partials  (#65)

                * Extract jinja_partials code

                * Remove Plotly dependency from setup.py

                * Fix CRISPRessoPooled flash errors (#68)

                * Fix replacing flash intermediate files with fastp intermediate files

                This also moves where the files are added to `files_to_remove` up to
                near where they are created.

                * Update to run test branch with paired end Pooled test

                * Add pooled-paired-sim test to integration tests

                * Replace flash and trimmomatic with fastp and remove plotly from Github Actions environment

                * Change test branch back to master

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

            commit f4858a30c43374f54058b3ad9c1e965e1ab7fb46
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Apr 23 17:00:28 2024 -0600

                Updated README (#64) (#424)

                * Updating README to fix argument, email, and formatting

                * removing superfluous files

                * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

                * Remove link to CRISPRessoPro

                * Replace Docker badge with link to tags

                * Add bullet points to Guardrails section and improve formatting

                * Fix typo and removed colons from guardrails

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

            commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Mon Apr 22 11:24:59 2024 -0600

                Update CRISPRessoPooledCORE.py (#423)

                Fix bug in error reporting if duplicate names are present

            commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Apr 18 16:55:39 2024 -0600

                Remove extra imports from CRISPRessoCore (#67) (#422)

            commit 4aae57e5be475cd717792265bee36a71a99425de
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Apr 18 10:00:19 2024 -0600

                Cole/refactor jinja undefined (#66) (#421)

                * Replace Jinja2 PackageLoader with FileSystemLoader

                The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
                and Python 3.9. Replacing with FileSystemLoader work with the older version and
                the latest version.

                * Fix undefined variable `amplicon_name` in report template

                * Refactor logging Jinja2 undefined variable warnings

                * Revert plot_11a update

                * Update intedration test branch

                * Update jinja to warn on undefined but not fail. Fix all undefined warnings

                * Fix github integration tests ref

                * One more undefined variable

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

            commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Apr 9 17:30:10 2024 -0600

                Fix Jinja2 undefined variables (#63) (#417)

                * Replace Jinja2 PackageLoader with FileSystemLoader

                The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
                and Python 3.9. Replacing with FileSystemLoader work with the older version and
                the latest version.

                * Fix undefined variable `amplicon_name` in report template

                * Revert plot_11a update

                * Update intedration test branch

                * Update branch for integration tests

            commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
            Author: Han Dai <github@daihan.me>
            Date:   Fri Apr 5 18:36:41 2024 -0400

                fix: change all U+00A0 to U+0020 (#400)

            commit 235dc29c0cd0fcca2e999148d4660acf00b07221
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri Apr 5 16:36:16 2024 -0600

                Fastp, args as data, guardrails, and PE fix (#415)

                * Change CRISPResso_status.txt format to JSON (#46)

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * add json read for status file

                * changed Formatter to json format

                * fixed json access variable name: message

                * changed  perentage_complete to numeric

                * changed status file to .json

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * New makefile commands

                * changed file to .json

                * changed status to json file

                * Make JSON human readable by adding new lines

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * point to test branch

                * pointed CI config to testing branch

                * Update integration_tests.yml

                point to master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

                * Trevor/fastp integration (#50)

                * Update check_program to check versions and create check_fastq function

                * Update fastq arg, implement fastp in get_most_frequent_reads

                * Bump version to 2.3.0

                * Deprecate Flash and Trimmomatic parameters, and update fastp params

                * Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

                * Implement trimming of single end reads

                * Merge (and trim) reads in CRISPRessoCORE with fastp

                * Modify error handling to account for fastp errors

                * Replace flash and trimmomatic with fastp in Docker dependencies

                * Update LICENSE.txt with fastp info

                * Remove min and max amplicon length (no longer needed)

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Implement trimming with fastp in CRISPRessoPooled

                * Implemend merging (and trimming) with fastp in CRISPRessoPooled

                * Fixed minor fastp errors

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * Update where the test point to

                * Fix 'Prime-edited' key not found (#32)

                * Move 'Prime-edited' amplicon name check

                By moving this, it will check if there is an amplicon named
                'Prime-edited' (which is a reserved name) even if the
                `prime_editing_pegRNA_extension_seq` parameter is empty.

                * Only search for scaffold integration when pegRNA extension seq is provided

                * Remove spaces at the end of lines

                * Docker size (#49)

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * 3.4->2.08

                * Put ttf-mscorefonts-installer back above apt-get clean

                * restore slash, replace fastp with trimmomatic and flash, add autoremove step

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * initial readme modifications

                * Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

                * Pointing test branch back at master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

                * Guardrails clean history (#34)

                * Include guardrail functions

                * Add CRISPRessoReports subtree

                * Refactor to use CRISPRessoReports module

                * Include guardrail functions

                * Functional guardrails, needs reports update

                * Add guardrail partial

                * fix guardrials partial

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Update C cythonized files

                * Add exact numbers to guardrails printouts

                * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

                * Fix calculation of `total_mods` from being negative

                The issue was that `all_deletion_coordinates` just tells you how many deletions
                were present, but not how long the deletion is.

                * Changes to message

                * Remove old tag

                * Point tests at guardrails

                * Restore C2 pro check

                * Save message with guardrail name

                * Point tests repo at master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

                * Fix case sensitivity in Prime Editing mode (#54)

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * Make all amplicons in amplicon_seq_arr uppercase

                This fixes https://github.com/pinellolab/CRISPResso2/issues/396

                * Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

                * Fix 'Prime-edited' key not found (#32)

                * Move 'Prime-edited' amplicon name check

                By moving this, it will check if there is an amplicon named
                'Prime-edited' (which is a reserved name) even if the
                `prime_editing_pegRNA_extension_seq` parameter is empty.

                * Only search for scaffold integration when pegRNA extension seq is provided

                * Remove spaces at the end of lines

                * Docker size (#49)

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

   …
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Aug 22, 2024
commit bb7533405af9f355ee9b367903e1f391375c7ca8
Merge: 354f962 2eff6a1
Author: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Date:   Thu Aug 22 13:47:21 2024 -0600

    Merge branch 'master' into c2pro-reports

commit 354f962d4201ae4784108b0a89467796af6ec326
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:49:32 2024 -0600

    specify encoding

commit 823250b8108ede27b29d59d1239c74c93d74395f
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:46:17 2024 -0600

    changed _ROOT to _root

commit fb8cfa7614598f23e578b55b92ca9b685eef3156
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:44:32 2024 -0600

    added docstrings

commit e0777a805e4da9729118b429fb44687ecc15d590
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:32:34 2024 -0600

    fixes for linting

commit 3ade759b85992484ae59aa7db3f10fe8e6bbdc50
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:04:43 2024 -0600

    Squashed commit of the following:

    commit 42be4bb0bcd58cdf9c902a448a7e5bde888fb1d3
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Mon Aug 19 14:36:55 2024 -0600

        added pro check for plotly import in batchReport

    commit 31873d15fff9b9b12c1e8d8c62efa686c12cbd37
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Fri Aug 16 15:05:58 2024 -0600

        pointed integration tests at test branch

    commit d449600561074c8721322e94a8375b3ad742a88c
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Fri Aug 16 14:24:03 2024 -0600

        Squashed commit of the following:

        commit 6ec98a05ee70f85b5aa0ac15ab6094b7f1f20d08
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Tue Aug 13 16:44:39 2024 -0600

            dict key changes

        commit 7cfd5acf06da4eb6f49453144ee1fed1e1488a7a
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Thu Aug 8 15:30:31 2024 -0600

            added C2PRO install check back

        commit bfb0003329ea61b5c79c7e1df8d9a73ec5a508db
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Fri Aug 2 13:08:12 2024 -0600

            fixed key error conditionals

        commit 84444e7480605206cb3efa4a0db675c55e717304
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Fri Aug 2 09:22:44 2024 -0600

            use local jinja_paritals file

        commit 71dd12786fec6c4aba0170a3bfd9022b06f5eede
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Wed Jul 31 14:10:29 2024 -0600

            Squashed commit of the following:

            commit 5e3b30515c4bc437127e7fb21f53cb0bd511c4ca
            Author: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
            Date:   Mon Jul 22 09:31:44 2024 -0600

                D3-Enhancements (#78)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Provide sgRNA_sequences to plot_nucleotide_quilt plots

                * Passing sgRNA_sequences to plot

                * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

                * Add max-height to Batch report samples

                * Change testing branch

                * Fix wrong check for large Batch plots

                * Fix typo and move flexiguide to debug (#77)

                * Change flexiguide output to debug level

                * Fix typo in fastp merged output file name

                * Adding id tags for d3 script enhancements

                * pointing to test branch

                * Add amplicon_name parameter to allele heatmap and line plots

                * Add function to extract quantification window regions from include_idxs

                * Scale the quantification window according to the coordinates of the sgRNA plot

                * added c2pro check, added space in args.json

                * Correct the quantification window indexes for multiple guides

                * Fix name of nucleotide conversion plot when guides are not the same

                * Fix jinja variables that aren't found

                * Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

                * Remove unneeded variable and extra whitespace

                * Switch test branch to master

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

            commit 09e5d9720ad21e44fc7916d71bde3fd7a9dfa7ef
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu Jul 18 14:31:54 2024 -0600

                Asymmetrical cut point (#457)

                * add cut_point_ind to plot_alleles_heatmap for asymmetrical plotting

                * Cole asymmetrical cut point (#453)

                * Pin versions of numpy and matplotlib in CI environment (#84) (#452)

                * Reduce duplication and implement cut_point_ind in plot_alleles_heatmap_hist

                ---------

                Co-authored-by: Cole Lyman <Cole@colelyman.com>

            commit 8d92972694ddff629dad844a6ad100459f69751d
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Jul 18 14:29:40 2024 -0600

                Cole/update args (#85) (#456)

            commit 44f692ecabf5e2eb96ee0cfd7bae62343da7810c
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon Jul 15 16:17:29 2024 -0600

                Implement new pooled mixed-mode default behavior (#454)

                * changes for pooled mixed-mode default (#83)

                * changes for pooled mixed-mode default

                * deprecated old arg

                * added integration tests for mixed mode

                * fixed test target

                * updated test name

                * pinned numpy

                * Fix integration tests yml

                * pinning matplotlib

                * added print to CI tests

                * changed mixed mode info string

                * Remove pooled-mixed-mode-align-to-genome step from Github Actions

                * Update demultiplex_genome_wide parameter and help

                * Convert args.json to unix line endings

                * Add Pooled mixed mode demux run

                * Update the name of the argument in Pooled

                * Point integration tests back to master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Revert change to pooled mixed mode info statement (#86)

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 79b482b55a0e8edbc03ec22bd2714bade1e90323
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Jul 9 12:53:23 2024 -0600

                Pin versions of numpy and matplotlib in CI environment (#84) (#452)

            commit 80dc1bdd72d50f989717bfc5f8156bc3495c45f4
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 30 14:07:42 2024 -0600

                Add padding to image

            commit 381755daf0939aaf2745df0a802c809633aff47d
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 30 13:59:57 2024 -0600

                White background for schematic for dark mode

            commit d649db71e610bd8840fbb8d46fadb07789b67390
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri May 24 12:45:53 2024 -0600

                Fix typo and move flexiguide to debug (#77) (#438)

                * Change flexiguide output to debug level

                * Fix typo in fastp merged output file name

            commit 71181f50ef2b39015523b1a71d9fd1bf0dce14eb
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon May 13 13:34:00 2024 -0600

                Prefix the release Docker tag with a `v` (#434)

            commit d2c2be18a6bb64b0e742cc24c4665980a24324bc
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon May 13 09:41:32 2024 -0600

                Showing sgRNA sequences on hover in CRISPRessoPro (#432)

                * Passing sgRNA sequences to regular and Batch D3 plots (#73)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Provide sgRNA_sequences to plot_nucleotide_quilt plots

                * Passing sgRNA_sequences to plot

                * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

                * Add max-height to Batch report samples

                * Change testing branch

                * Fix wrong check for large Batch plots

                * Update integration_tests.yml to point back at master

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Push new releases to ECR (#74)

                * Create aws_ecr.yml (#1)

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * us-east-1

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Fix d3 sgRNA sequences (#76)

                * Pass correct sgRNA_sequences to d3 plot

                * Pass correct sgRNA sequence to prime editor plot for d3

                * Resize plotly (#75)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Pass div id for plotly

                * Remove debug

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 1c504274818b6b17fb60620d48fd92cb2e50566d
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu May 9 14:16:25 2024 -0600

                Fix plots and improve plot error handling (#431)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit acb2ea8e26dff4cd11f71301b344f81b1cec9040
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 2 13:49:33 2024 -0600

                Use recent docker image for CircleCI testing that includes updated pandas

            commit 38fd76dbd7ce2087468f9f454b548777de959a68
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed May 1 16:42:28 2024 -0600

                Cole/fix status file name (#69) (#430)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

            commit 3ec22e5fd09e432c9997d30e5f9ee51a2cc00d7b
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Wed May 1 13:08:11 2024 -0600

                Remove linked space in readme

            commit 340a4e16795a5e500411e11572ec267525985009
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed May 1 13:07:14 2024 -0600

                Fix batch mode pandas warning. (#70) (#429)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 1bc9e906f0ded81f80761d1ec375ee50a4f882a9
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri Apr 26 16:26:27 2024 -0600

                Bump version to 2.3.1 and change default CRISPRessoPooled behavior to change in 2.3.2 (#428)

            commit 5638a1f6ffa973231f23422e9c757fa8cd4af7cc
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Wed Apr 24 18:00:43 2024 -0600

                Spelling fixes

            commit d6011f29db16d8fc1c1e7222457b7f9a1f671de6
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed Apr 24 09:33:53 2024 -0600

                Extract `jinja_partials` and fix CRISPRessoPooled fastp errors (#425)

                * Updated README (#64)

                * Updating README to fix argument, email, and formatting

                * removing superfluous files

                * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

                * Remove link to CRISPRessoPro

                * Replace Docker badge with link to tags

                * Add bullet points to Guardrails section and improve formatting

                * Fix typo and removed colons from guardrails

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Extract jinja_partials  (#65)

                * Extract jinja_partials code

                * Remove Plotly dependency from setup.py

                * Fix CRISPRessoPooled flash errors (#68)

                * Fix replacing flash intermediate files with fastp intermediate files

                This also moves where the files are added to `files_to_remove` up to
                near where they are created.

                * Update to run test branch with paired end Pooled test

                * Add pooled-paired-sim test to integration tests

                * Replace flash and trimmomatic with fastp and remove plotly from Github Actions environment

                * Change test branch back to master

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

            commit f4858a30c43374f54058b3ad9c1e965e1ab7fb46
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Apr 23 17:00:28 2024 -0600

                Updated README (#64) (#424)

                * Updating README to fix argument, email, and formatting

                * removing superfluous files

                * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

                * Remove link to CRISPRessoPro

                * Replace Docker badge with link to tags

                * Add bullet points to Guardrails section and improve formatting

                * Fix typo and removed colons from guardrails

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

            commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Mon Apr 22 11:24:59 2024 -0600

                Update CRISPRessoPooledCORE.py (#423)

                Fix bug in error reporting if duplicate names are present

            commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Apr 18 16:55:39 2024 -0600

                Remove extra imports from CRISPRessoCore (#67) (#422)

            commit 4aae57e5be475cd717792265bee36a71a99425de
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Apr 18 10:00:19 2024 -0600

                Cole/refactor jinja undefined (#66) (#421)

                * Replace Jinja2 PackageLoader with FileSystemLoader

                The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
                and Python 3.9. Replacing with FileSystemLoader work with the older version and
                the latest version.

                * Fix undefined variable `amplicon_name` in report template

                * Refactor logging Jinja2 undefined variable warnings

                * Revert plot_11a update

                * Update intedration test branch

                * Update jinja to warn on undefined but not fail. Fix all undefined warnings

                * Fix github integration tests ref

                * One more undefined variable

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

            commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Apr 9 17:30:10 2024 -0600

                Fix Jinja2 undefined variables (#63) (#417)

                * Replace Jinja2 PackageLoader with FileSystemLoader

                The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
                and Python 3.9. Replacing with FileSystemLoader work with the older version and
                the latest version.

                * Fix undefined variable `amplicon_name` in report template

                * Revert plot_11a update

                * Update intedration test branch

                * Update branch for integration tests

            commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
            Author: Han Dai <github@daihan.me>
            Date:   Fri Apr 5 18:36:41 2024 -0400

                fix: change all U+00A0 to U+0020 (#400)

            commit 235dc29c0cd0fcca2e999148d4660acf00b07221
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri Apr 5 16:36:16 2024 -0600

                Fastp, args as data, guardrails, and PE fix (#415)

                * Change CRISPResso_status.txt format to JSON (#46)

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * add json read for status file

                * changed Formatter to json format

                * fixed json access variable name: message

                * changed  perentage_complete to numeric

                * changed status file to .json

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * New makefile commands

                * changed file to .json

                * changed status to json file

                * Make JSON human readable by adding new lines

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * point to test branch

                * pointed CI config to testing branch

                * Update integration_tests.yml

                point to master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

                * Trevor/fastp integration (#50)

                * Update check_program to check versions and create check_fastq function

                * Update fastq arg, implement fastp in get_most_frequent_reads

                * Bump version to 2.3.0

                * Deprecate Flash and Trimmomatic parameters, and update fastp params

                * Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

                * Implement trimming of single end reads

                * Merge (and trim) reads in CRISPRessoCORE with fastp

                * Modify error handling to account for fastp errors

                * Replace flash and trimmomatic with fastp in Docker dependencies

                * Update LICENSE.txt with fastp info

                * Remove min and max amplicon length (no longer needed)

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Implement trimming with fastp in CRISPRessoPooled

                * Implemend merging (and trimming) with fastp in CRISPRessoPooled

                * Fixed minor fastp errors

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * Update where the test point to

                * Fix 'Prime-edited' key not found (#32)

                * Move 'Prime-edited' amplicon name check

                By moving this, it will check if there is an amplicon named
                'Prime-edited' (which is a reserved name) even if the
                `prime_editing_pegRNA_extension_seq` parameter is empty.

                * Only search for scaffold integration when pegRNA extension seq is provided

                * Remove spaces at the end of lines

                * Docker size (#49)

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * 3.4->2.08

                * Put ttf-mscorefonts-installer back above apt-get clean

                * restore slash, replace fastp with trimmomatic and flash, add autoremove step

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * initial readme modifications

                * Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

                * Pointing test branch back at master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

                * Guardrails clean history (#34)

                * Include guardrail functions

                * Add CRISPRessoReports subtree

                * Refactor to use CRISPRessoReports module

                * Include guardrail functions

                * Functional guardrails, needs reports update

                * Add guardrail partial

                * fix guardrials partial

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Update C cythonized files

                * Add exact numbers to guardrails printouts

                * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

                * Fix calculation of `total_mods` from being negative

                The issue was that `all_deletion_coordinates` just tells you how many deletions
                were present, but not how long the deletion is.

                * Changes to message

                * Remove old tag

                * Point tests at guardrails

                * Restore C2 pro check

                * Save message with guardrail name

                * Point tests repo at master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

                * Fix case sensitivity in Prime Editing mode (#54)

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * Make all amplicons in amplicon_seq_arr uppercase

                This fixes https://github.com/pinellolab/CRISPResso2/issues/396

                * Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

                * Fix 'Prime-edited' key not found (#32)

                * Move 'Prime-edited' amplicon name check

                By moving this, it will check if there is an amplicon named
                'Prime-edited' (which is a reserved name) even if the
                `prime_editing_pegRNA_extension_seq` parameter is empty.

                * Only search for scaffold integration when pegRNA extension seq is provided

                * Remove spaces at the end of lines

                * Docker size (#49)

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no t…
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Aug 22, 2024
commit ae22c92e10c757667847a043eddef5a2fe333be7
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Thu Aug 22 16:12:08 2024 -0600

    fix cup download

commit f4f8a9027a4742b883c562e31fc7fe5f45a5f8cf
Merge: 2eff6a1 bb75334
Author: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Date:   Thu Aug 22 15:50:20 2024 -0600

    Merge pull request #24 from edilytics/c2pro-reports

    C2pro reports

commit bb7533405af9f355ee9b367903e1f391375c7ca8
Merge: 354f962 2eff6a1
Author: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Date:   Thu Aug 22 13:47:21 2024 -0600

    Merge branch 'master' into c2pro-reports

commit 354f962d4201ae4784108b0a89467796af6ec326
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:49:32 2024 -0600

    specify encoding

commit 823250b8108ede27b29d59d1239c74c93d74395f
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:46:17 2024 -0600

    changed _ROOT to _root

commit fb8cfa7614598f23e578b55b92ca9b685eef3156
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:44:32 2024 -0600

    added docstrings

commit e0777a805e4da9729118b429fb44687ecc15d590
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:32:34 2024 -0600

    fixes for linting

commit 3ade759b85992484ae59aa7db3f10fe8e6bbdc50
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Mon Aug 19 16:04:43 2024 -0600

    Squashed commit of the following:

    commit 42be4bb0bcd58cdf9c902a448a7e5bde888fb1d3
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Mon Aug 19 14:36:55 2024 -0600

        added pro check for plotly import in batchReport

    commit 31873d15fff9b9b12c1e8d8c62efa686c12cbd37
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Fri Aug 16 15:05:58 2024 -0600

        pointed integration tests at test branch

    commit d449600561074c8721322e94a8375b3ad742a88c
    Author: mbowcut2 <mbowcut@gmail.com>
    Date:   Fri Aug 16 14:24:03 2024 -0600

        Squashed commit of the following:

        commit 6ec98a05ee70f85b5aa0ac15ab6094b7f1f20d08
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Tue Aug 13 16:44:39 2024 -0600

            dict key changes

        commit 7cfd5acf06da4eb6f49453144ee1fed1e1488a7a
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Thu Aug 8 15:30:31 2024 -0600

            added C2PRO install check back

        commit bfb0003329ea61b5c79c7e1df8d9a73ec5a508db
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Fri Aug 2 13:08:12 2024 -0600

            fixed key error conditionals

        commit 84444e7480605206cb3efa4a0db675c55e717304
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Fri Aug 2 09:22:44 2024 -0600

            use local jinja_paritals file

        commit 71dd12786fec6c4aba0170a3bfd9022b06f5eede
        Author: mbowcut2 <mbowcut@gmail.com>
        Date:   Wed Jul 31 14:10:29 2024 -0600

            Squashed commit of the following:

            commit 5e3b30515c4bc437127e7fb21f53cb0bd511c4ca
            Author: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
            Date:   Mon Jul 22 09:31:44 2024 -0600

                D3-Enhancements (#78)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Provide sgRNA_sequences to plot_nucleotide_quilt plots

                * Passing sgRNA_sequences to plot

                * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

                * Add max-height to Batch report samples

                * Change testing branch

                * Fix wrong check for large Batch plots

                * Fix typo and move flexiguide to debug (#77)

                * Change flexiguide output to debug level

                * Fix typo in fastp merged output file name

                * Adding id tags for d3 script enhancements

                * pointing to test branch

                * Add amplicon_name parameter to allele heatmap and line plots

                * Add function to extract quantification window regions from include_idxs

                * Scale the quantification window according to the coordinates of the sgRNA plot

                * added c2pro check, added space in args.json

                * Correct the quantification window indexes for multiple guides

                * Fix name of nucleotide conversion plot when guides are not the same

                * Fix jinja variables that aren't found

                * Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

                * Remove unneeded variable and extra whitespace

                * Switch test branch to master

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

            commit 09e5d9720ad21e44fc7916d71bde3fd7a9dfa7ef
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu Jul 18 14:31:54 2024 -0600

                Asymmetrical cut point (#457)

                * add cut_point_ind to plot_alleles_heatmap for asymmetrical plotting

                * Cole asymmetrical cut point (#453)

                * Pin versions of numpy and matplotlib in CI environment (#84) (#452)

                * Reduce duplication and implement cut_point_ind in plot_alleles_heatmap_hist

                ---------

                Co-authored-by: Cole Lyman <Cole@colelyman.com>

            commit 8d92972694ddff629dad844a6ad100459f69751d
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Jul 18 14:29:40 2024 -0600

                Cole/update args (#85) (#456)

            commit 44f692ecabf5e2eb96ee0cfd7bae62343da7810c
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon Jul 15 16:17:29 2024 -0600

                Implement new pooled mixed-mode default behavior (#454)

                * changes for pooled mixed-mode default (#83)

                * changes for pooled mixed-mode default

                * deprecated old arg

                * added integration tests for mixed mode

                * fixed test target

                * updated test name

                * pinned numpy

                * Fix integration tests yml

                * pinning matplotlib

                * added print to CI tests

                * changed mixed mode info string

                * Remove pooled-mixed-mode-align-to-genome step from Github Actions

                * Update demultiplex_genome_wide parameter and help

                * Convert args.json to unix line endings

                * Add Pooled mixed mode demux run

                * Update the name of the argument in Pooled

                * Point integration tests back to master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Revert change to pooled mixed mode info statement (#86)

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 79b482b55a0e8edbc03ec22bd2714bade1e90323
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Jul 9 12:53:23 2024 -0600

                Pin versions of numpy and matplotlib in CI environment (#84) (#452)

            commit 80dc1bdd72d50f989717bfc5f8156bc3495c45f4
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 30 14:07:42 2024 -0600

                Add padding to image

            commit 381755daf0939aaf2745df0a802c809633aff47d
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 30 13:59:57 2024 -0600

                White background for schematic for dark mode

            commit d649db71e610bd8840fbb8d46fadb07789b67390
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri May 24 12:45:53 2024 -0600

                Fix typo and move flexiguide to debug (#77) (#438)

                * Change flexiguide output to debug level

                * Fix typo in fastp merged output file name

            commit 71181f50ef2b39015523b1a71d9fd1bf0dce14eb
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon May 13 13:34:00 2024 -0600

                Prefix the release Docker tag with a `v` (#434)

            commit d2c2be18a6bb64b0e742cc24c4665980a24324bc
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Mon May 13 09:41:32 2024 -0600

                Showing sgRNA sequences on hover in CRISPRessoPro (#432)

                * Passing sgRNA sequences to regular and Batch D3 plots (#73)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Provide sgRNA_sequences to plot_nucleotide_quilt plots

                * Passing sgRNA_sequences to plot

                * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

                * Add max-height to Batch report samples

                * Change testing branch

                * Fix wrong check for large Batch plots

                * Update integration_tests.yml to point back at master

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Push new releases to ECR (#74)

                * Create aws_ecr.yml (#1)

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * us-east-1

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Update aws_ecr.yml

                * Fix d3 sgRNA sequences (#76)

                * Pass correct sgRNA_sequences to d3 plot

                * Pass correct sgRNA sequence to prime editor plot for d3

                * Resize plotly (#75)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                * Pass div id for plotly

                * Remove debug

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 1c504274818b6b17fb60620d48fd92cb2e50566d
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu May 9 14:16:25 2024 -0600

                Fix plots and improve plot error handling (#431)

                * Sam/try plots (#71)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Point test to try-plots

                * Fix d3 not showing and plotly mixing with matplotlib

                * Use logger for warnings and debug statements

                * Point tests back at master

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Sam/fix plots (#72)

                * Fix batch mode pandas warning. (#70)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Functional

                * Cole/fix status file name (#69)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

                * Try catch all futures

                * Fix test fail plots

                * Fix d3 not showing and plotly mixing with matplotlib

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Remove token from integration tests file

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit acb2ea8e26dff4cd11f71301b344f81b1cec9040
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Thu May 2 13:49:33 2024 -0600

                Use recent docker image for CircleCI testing that includes updated pandas

            commit 38fd76dbd7ce2087468f9f454b548777de959a68
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed May 1 16:42:28 2024 -0600

                Cole/fix status file name (#69) (#430)

                * Update config file logging messages

                This removes printing the exception (which is essentially a duplicate),
                and adds a condition if no config file was provided. Also changes `json`
                to `config` so that it is more clear.

                * Fix divide by zero when no amplicons are present in Batch mode

                * Don't append file_prefix to status file name

                * Place status files in output directories

                * Update tests branch for file_prefix addition

                * Load D3 and plotly figures with pro with multiple amplicons

                * Update batch

                * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

                Before this fix, when using a file_prefix the second run that was compared
                would not be displayed as a data in the first figure of the report.

                * Import CRISPRessoPro instead of importing the version

                When installed via conda, the version is not available

                * Remove `get_amplicon_output` unused function from CRISPRessoCompare

                Also remove unused argparse import

                * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

                * Allow for matching of multiple guides in the same amplicon

                * Fix pandas FutureWarning

                * Change test branch back to master

                ---------

                Co-authored-by: Sam <snic9004@gmail.com>

            commit 3ec22e5fd09e432c9997d30e5f9ee51a2cc00d7b
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Wed May 1 13:08:11 2024 -0600

                Remove linked space in readme

            commit 340a4e16795a5e500411e11572ec267525985009
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed May 1 13:07:14 2024 -0600

                Fix batch mode pandas warning. (#70) (#429)

                * refactor to call method on DataFrame, rather than Series.
                Removes warning.

                * Fix pandas future warning in CRISPRessoWGS

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

            commit 1bc9e906f0ded81f80761d1ec375ee50a4f882a9
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri Apr 26 16:26:27 2024 -0600

                Bump version to 2.3.1 and change default CRISPRessoPooled behavior to change in 2.3.2 (#428)

            commit 5638a1f6ffa973231f23422e9c757fa8cd4af7cc
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Wed Apr 24 18:00:43 2024 -0600

                Spelling fixes

            commit d6011f29db16d8fc1c1e7222457b7f9a1f671de6
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Wed Apr 24 09:33:53 2024 -0600

                Extract `jinja_partials` and fix CRISPRessoPooled fastp errors (#425)

                * Updated README (#64)

                * Updating README to fix argument, email, and formatting

                * removing superfluous files

                * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

                * Remove link to CRISPRessoPro

                * Replace Docker badge with link to tags

                * Add bullet points to Guardrails section and improve formatting

                * Fix typo and removed colons from guardrails

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Extract jinja_partials  (#65)

                * Extract jinja_partials code

                * Remove Plotly dependency from setup.py

                * Fix CRISPRessoPooled flash errors (#68)

                * Fix replacing flash intermediate files with fastp intermediate files

                This also moves where the files are added to `files_to_remove` up to
                near where they are created.

                * Update to run test branch with paired end Pooled test

                * Add pooled-paired-sim test to integration tests

                * Replace flash and trimmomatic with fastp and remove plotly from Github Actions environment

                * Change test branch back to master

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

            commit f4858a30c43374f54058b3ad9c1e965e1ab7fb46
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Apr 23 17:00:28 2024 -0600

                Updated README (#64) (#424)

                * Updating README to fix argument, email, and formatting

                * removing superfluous files

                * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

                * Remove link to CRISPRessoPro

                * Replace Docker badge with link to tags

                * Add bullet points to Guardrails section and improve formatting

                * Fix typo and removed colons from guardrails

                ---------

                Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

            commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
            Author: Kendell Clement <k.clement.dev@gmail.com>
            Date:   Mon Apr 22 11:24:59 2024 -0600

                Update CRISPRessoPooledCORE.py (#423)

                Fix bug in error reporting if duplicate names are present

            commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Apr 18 16:55:39 2024 -0600

                Remove extra imports from CRISPRessoCore (#67) (#422)

            commit 4aae57e5be475cd717792265bee36a71a99425de
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Thu Apr 18 10:00:19 2024 -0600

                Cole/refactor jinja undefined (#66) (#421)

                * Replace Jinja2 PackageLoader with FileSystemLoader

                The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
                and Python 3.9. Replacing with FileSystemLoader work with the older version and
                the latest version.

                * Fix undefined variable `amplicon_name` in report template

                * Refactor logging Jinja2 undefined variable warnings

                * Revert plot_11a update

                * Update intedration test branch

                * Update jinja to warn on undefined but not fail. Fix all undefined warnings

                * Fix github integration tests ref

                * One more undefined variable

                ---------

                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

            commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Tue Apr 9 17:30:10 2024 -0600

                Fix Jinja2 undefined variables (#63) (#417)

                * Replace Jinja2 PackageLoader with FileSystemLoader

                The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
                and Python 3.9. Replacing with FileSystemLoader work with the older version and
                the latest version.

                * Fix undefined variable `amplicon_name` in report template

                * Revert plot_11a update

                * Update intedration test branch

                * Update branch for integration tests

            commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
            Author: Han Dai <github@daihan.me>
            Date:   Fri Apr 5 18:36:41 2024 -0400

                fix: change all U+00A0 to U+0020 (#400)

            commit 235dc29c0cd0fcca2e999148d4660acf00b07221
            Author: Cole Lyman <Cole@colelyman.com>
            Date:   Fri Apr 5 16:36:16 2024 -0600

                Fastp, args as data, guardrails, and PE fix (#415)

                * Change CRISPResso_status.txt format to JSON (#46)

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * add json read for status file

                * changed Formatter to json format

                * fixed json access variable name: message

                * changed  perentage_complete to numeric

                * changed status file to .json

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * New makefile commands

                * changed file to .json

                * changed status to json file

                * Make JSON human readable by adding new lines

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * point to test branch

                * pointed CI config to testing branch

                * Update integration_tests.yml

                point to master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

                * Trevor/fastp integration (#50)

                * Update check_program to check versions and create check_fastq function

                * Update fastq arg, implement fastp in get_most_frequent_reads

                * Bump version to 2.3.0

                * Deprecate Flash and Trimmomatic parameters, and update fastp params

                * Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

                * Implement trimming of single end reads

                * Merge (and trim) reads in CRISPRessoCORE with fastp

                * Modify error handling to account for fastp errors

                * Replace flash and trimmomatic with fastp in Docker dependencies

                * Update LICENSE.txt with fastp info

                * Remove min and max amplicon length (no longer needed)

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Implement trimming with fastp in CRISPRessoPooled

                * Implemend merging (and trimming) with fastp in CRISPRessoPooled

                * Fixed minor fastp errors

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * Update where the test point to

                * Fix 'Prime-edited' key not found (#32)

                * Move 'Prime-edited' amplicon name check

                By moving this, it will check if there is an amplicon named
                'Prime-edited' (which is a reserved name) even if the
                `prime_editing_pegRNA_extension_seq` parameter is empty.

                * Only search for scaffold integration when pegRNA extension seq is provided

                * Remove spaces at the end of lines

                * Docker size (#49)

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * 3.4->2.08

                * Put ttf-mscorefonts-installer back above apt-get clean

                * restore slash, replace fastp with trimmomatic and flash, add autoremove step

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * initial readme modifications

                * Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

                * Pointing test branch back at master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

                * Guardrails clean history (#34)

                * Include guardrail functions

                * Add CRISPRessoReports subtree

                * Refactor to use CRISPRessoReports module

                * Include guardrail functions

                * Functional guardrails, needs reports update

                * Add guardrail partial

                * fix guardrials partial

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * GitHub actions integration tests (#48)

                * GitHub actions clean (#40)

                * Create pytest.yml

                * Create pylint.yml

                * Create .pylintrc

                * Create test_env.yml

                * Full path

                * Remove conda install

                * Replace path

                * Pytest tests

                * pip -e

                * Create integration_tests.yml

                * Simplify name

                * CRISPRESSO2_DIR environment variable

                * Up one dir

                * ls workspace

                * Install CRISPResso and ydiff

                * Clone repo instead of checkout

                * submodule

                * ls

                * CRISPResso2_copy

                * ls

                * Update env

                * Simplify

                * Pull from githubactions branch

                * Pull githubactions repo

                * Checkout githubactions

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Run tests individually

                * Pin plotly version

                * Run all tests even if one fails

                * Test on another branch

                * Switch branch with token

                * Update integration_tests.yml

                * Introduce pandas sorting in CRISPRessoCompare (#47)

                * New makefile commands

                * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

                * Extract out split_interleaved_fastq function to CRISPRessoShared

                * Implement splitting interleaved fastq files in CRISPRessoPooled

                * Suppress split_interleaved_input from CRISPRessoWGS parameters

                * Suppress other parameters in CRISPRessoWGS

                * Move where interleaved fastq files are split to be trimmed properly

                * Bug Fix - 367 (#35)

                * - Fixed references to ref_names_for_pe

                * removed extra tabs

                * trying to match empty line, no tabs

                * - changed references to ref_names[0]

                * Mckay/pd warnings (#45)

                * refactor errors='ignore' to try except

                * refactored integer slice to iloc[]

                * moved to_numeric try except to function

                * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

                This change is slightly cleaner because it addresses the root issue that some
                columns are strings (and can therefore not be converted to numeric types). Now
                if an error does occur when converting the dfs to numeric types it won't be
                swallowed up.

                * Add documentation to to_numeric_ignore_columns

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * On push no branches

                * On push no branches

                * All in one file

                * Fix yml errors

                * Rename jobs

                * Remove old workflow files

                * Remove paths

                * Run jobs in parallel

                ---------

                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
                Co-authored-by: Cole Lyman <cole@colelyman.com>

                * Update C cythonized files

                * Add exact numbers to guardrails printouts

                * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

                * Fix calculation of `total_mods` from being negative

                The issue was that `all_deletion_coordinates` just tells you how many deletions
                were present, but not how long the deletion is.

                * Changes to message

                * Remove old tag

                * Point tests at guardrails

                * Restore C2 pro check

                * Save message with guardrail name

                * Point tests repo at master

                ---------

                Co-authored-by: Cole Lyman <cole@colelyman.com>
                Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

                * Fix case sensitivity in Prime Editing mode (#54)

                * Move read filtering to after merging in CRISPResso (#39)

                * Move read filtering to after merging

                This is in an effort to be consistent with the behavior and results of
                CRISPRessoPooled.

                * Properly assign the correct file names for read filtering

                * Add space around operators

                * GitHub actions on pr (#51)

                * Run integration tests on pull_request

                * Run pytest on pull_request

                * Run pylint on pull_request

                * Run tests on PR only when opening PR (#53)

                * Update reports (#52)

                * Update report changes

                * Switch branch of integration test repo

                * Remove extraneous `crispresso_data_path`

                * Point integration tests back to master

                * Make all amplicons in amplicon_seq_arr uppercase

                This fixes https://github.com/pinellolab/CRISPResso2/issues/396

                * Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

                * Fix 'Prime-edited' key not found (#32)

                * Move 'Prime-edited' amplicon name check

                By moving this, it will check if there is an amplicon named
                'Prime-edited' (which is a reserved name) even if the
                `prime_editing_pegRNA_extension…
mbowcut2 added a commit to edilytics/CRISPResso2 that referenced this issue Aug 22, 2024
* Fix CRISPRessoAggregate bug and other improvements (#95)

* D3-Enhancements (#78)

* Sam/try plots (#71)

* Fix batch mode pandas warning. (#70)

* refactor to call method on DataFrame, rather than Series.
Removes warning.

* Fix pandas future warning in CRISPRessoWGS

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Functional

* Cole/fix status file name (#69)

* Update config file logging messages

This removes printing the exception (which is essentially a duplicate),
and adds a condition if no config file was provided. Also changes `json`
to `config` so that it is more clear.

* Fix divide by zero when no amplicons are present in Batch mode

* Don't append file_prefix to status file name

* Place status files in output directories

* Update tests branch for file_prefix addition

* Load D3 and plotly figures with pro with multiple amplicons

* Update batch

* Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

Before this fix, when using a file_prefix the second run that was compared
would not be displayed as a data in the first figure of the report.

* Import CRISPRessoPro instead of importing the version

When installed via conda, the version is not available

* Remove `get_amplicon_output` unused function from CRISPRessoCompare

Also remove unused argparse import

* Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

* Allow for matching of multiple guides in the same amplicon

* Fix pandas FutureWarning

* Change test branch back to master

---------

Co-authored-by: Sam <snic9004@gmail.com>

* Try catch all futures

* Fix test fail plots

* Point test to try-plots

* Fix d3 not showing and plotly mixing with matplotlib

* Use logger for warnings and debug statements

* Point tests back at master

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Sam/fix plots (#72)

* Fix batch mode pandas warning. (#70)

* refactor to call method on DataFrame, rather than Series.
Removes warning.

* Fix pandas future warning in CRISPRessoWGS

---------

Co-authored-by: Cole Lyman <cole@colelyman.com>

* Functional

* Cole/fix status file name (#69)

* Update config file logging messages

This removes printing the exception (which is essentially a duplicate),
and adds a condition if no config file was provided. Also changes `json`
to `config` so that it is more clear.

* Fix divide by zero when no amplicons are present in Batch mode

* Don't append file_prefix to status file name

* Place status files in output directories

* Update tests branch for file_prefix addition

* Load D3 and plotly figures with pro with multiple amplicons

* Update batch

* Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

Before this fix, when using a file_prefix the second run that was compared
would not be displayed as a data in the first figure of the report.

* Import CRISPRessoPro instead of importing the version

When installed via conda, the version is not available

* Remove `get_amplicon_output` unused function from CRISPRessoCompare

Also remove unused argparse import

* Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

* Allow for matching of multiple guides in the same amplicon

* Fix pandas FutureWarning

* Change test branch back to master

---------

Co-authored-by: Sam <snic9004@gmail.com>

* Try catch all futures

* Fix test fail plots

* Fix d3 not showing and plotly mixing with matplotlib

---------

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Remove token from integration tests file

* Provide sgRNA_sequences to plot_nucleotide_quilt plots

* Passing sgRNA_sequences to plot

* Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

* Add max-height to Batch report samples

* Change testing branch

* Fix wrong check for large Batch plots

* Fix typo and move flexiguide to debug (#77)

* Change flexiguide output to debug level

* Fix typo in fastp merged output file name

* Adding id tags for d3 script enhancements

* pointing to test branch

* Add amplicon_name parameter to allele heatmap and line plots

* Add function to extract quantification window regions from include_idxs

* Scale the quantification window according to the coordinates of the sgRNA plot

* added c2pro check, added space in args.json

* Correct the quantification window indexes for multiple guides

* Fix name of nucleotide conversion plot when guides are not the same

* Fix jinja variables that aren't found

* Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

* Remove unneeded variable and extra whitespace

* Switch test branch to master

---------

Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Cole Lyman <cole@colelyman.com>

* Add amplicon_name to plot functions

* Add sgRNA sequences to nucleotide quilt parameters in Aggregate

* Add custom_colors to Aggregate plot functions

* Update Aggregate and make_aggregate_report to have logger and tool

* Write command_used to Aggregate .json info file

* Point to new test branch and add Aggregate run

* Make the order of Aggregate runs explicit

* Sort all instances of crispresso2_folder_info in Aggregate

* Sort df_summary_quantification df in Aggregate

* Try sorting with a list of single column

* Update to correct test branch

* Move to master test branch

---------

Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

* Squashed commit of the following:

commit 6ec98a05ee70f85b5aa0ac15ab6094b7f1f20d08
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Tue Aug 13 16:44:39 2024 -0600

    dict key changes

commit 7cfd5acf06da4eb6f49453144ee1fed1e1488a7a
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Thu Aug 8 15:30:31 2024 -0600

    added C2PRO install check back

commit bfb0003329ea61b5c79c7e1df8d9a73ec5a508db
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Fri Aug 2 13:08:12 2024 -0600

    fixed key error conditionals

commit 84444e7480605206cb3efa4a0db675c55e717304
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Fri Aug 2 09:22:44 2024 -0600

    use local jinja_paritals file

commit 71dd12786fec6c4aba0170a3bfd9022b06f5eede
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Wed Jul 31 14:10:29 2024 -0600

    Squashed commit of the following:

    commit 5e3b30515c4bc437127e7fb21f53cb0bd511c4ca
    Author: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
    Date:   Mon Jul 22 09:31:44 2024 -0600

        D3-Enhancements (#78)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Provide sgRNA_sequences to plot_nucleotide_quilt plots

        * Passing sgRNA_sequences to plot

        * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

        * Add max-height to Batch report samples

        * Change testing branch

        * Fix wrong check for large Batch plots

        * Fix typo and move flexiguide to debug (#77)

        * Change flexiguide output to debug level

        * Fix typo in fastp merged output file name

        * Adding id tags for d3 script enhancements

        * pointing to test branch

        * Add amplicon_name parameter to allele heatmap and line plots

        * Add function to extract quantification window regions from include_idxs

        * Scale the quantification window according to the coordinates of the sgRNA plot

        * added c2pro check, added space in args.json

        * Correct the quantification window indexes for multiple guides

        * Fix name of nucleotide conversion plot when guides are not the same

        * Fix jinja variables that aren't found

        * Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

        * Remove unneeded variable and extra whitespace

        * Switch test branch to master

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

    commit 09e5d9720ad21e44fc7916d71bde3fd7a9dfa7ef
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 18 14:31:54 2024 -0600

        Asymmetrical cut point (#457)

        * add cut_point_ind to plot_alleles_heatmap for asymmetrical plotting

        * Cole asymmetrical cut point (#453)

        * Pin versions of numpy and matplotlib in CI environment (#84) (#452)

        * Reduce duplication and implement cut_point_ind in plot_alleles_heatmap_hist

        ---------

        Co-authored-by: Cole Lyman <Cole@colelyman.com>

    commit 8d92972694ddff629dad844a6ad100459f69751d
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Jul 18 14:29:40 2024 -0600

        Cole/update args (#85) (#456)

    commit 44f692ecabf5e2eb96ee0cfd7bae62343da7810c
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon Jul 15 16:17:29 2024 -0600

        Implement new pooled mixed-mode default behavior (#454)

        * changes for pooled mixed-mode default (#83)

        * changes for pooled mixed-mode default

        * deprecated old arg

        * added integration tests for mixed mode

        * fixed test target

        * updated test name

        * pinned numpy

        * Fix integration tests yml

        * pinning matplotlib

        * added print to CI tests

        * changed mixed mode info string

        * Remove pooled-mixed-mode-align-to-genome step from Github Actions

        * Update demultiplex_genome_wide parameter and help

        * Convert args.json to unix line endings

        * Add Pooled mixed mode demux run

        * Update the name of the argument in Pooled

        * Point integration tests back to master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Revert change to pooled mixed mode info statement (#86)

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 79b482b55a0e8edbc03ec22bd2714bade1e90323
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Jul 9 12:53:23 2024 -0600

        Pin versions of numpy and matplotlib in CI environment (#84) (#452)

    commit 80dc1bdd72d50f989717bfc5f8156bc3495c45f4
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 30 14:07:42 2024 -0600

        Add padding to image

    commit 381755daf0939aaf2745df0a802c809633aff47d
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 30 13:59:57 2024 -0600

        White background for schematic for dark mode

    commit d649db71e610bd8840fbb8d46fadb07789b67390
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri May 24 12:45:53 2024 -0600

        Fix typo and move flexiguide to debug (#77) (#438)

        * Change flexiguide output to debug level

        * Fix typo in fastp merged output file name

    commit 71181f50ef2b39015523b1a71d9fd1bf0dce14eb
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon May 13 13:34:00 2024 -0600

        Prefix the release Docker tag with a `v` (#434)

    commit d2c2be18a6bb64b0e742cc24c4665980a24324bc
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon May 13 09:41:32 2024 -0600

        Showing sgRNA sequences on hover in CRISPRessoPro (#432)

        * Passing sgRNA sequences to regular and Batch D3 plots (#73)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Provide sgRNA_sequences to plot_nucleotide_quilt plots

        * Passing sgRNA_sequences to plot

        * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

        * Add max-height to Batch report samples

        * Change testing branch

        * Fix wrong check for large Batch plots

        * Update integration_tests.yml to point back at master

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Push new releases to ECR (#74)

        * Create aws_ecr.yml (#1)

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * us-east-1

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Fix d3 sgRNA sequences (#76)

        * Pass correct sgRNA_sequences to d3 plot

        * Pass correct sgRNA sequence to prime editor plot for d3

        * Resize plotly (#75)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Pass div id for plotly

        * Remove debug

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 1c504274818b6b17fb60620d48fd92cb2e50566d
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu May 9 14:16:25 2024 -0600

        Fix plots and improve plot error handling (#431)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit acb2ea8e26dff4cd11f71301b344f81b1cec9040
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 2 13:49:33 2024 -0600

        Use recent docker image for CircleCI testing that includes updated pandas

    commit 38fd76dbd7ce2087468f9f454b548777de959a68
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 1 16:42:28 2024 -0600

        Cole/fix status file name (#69) (#430)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

    commit 3ec22e5fd09e432c9997d30e5f9ee51a2cc00d7b
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed May 1 13:08:11 2024 -0600

        Remove linked space in readme

    commit 340a4e16795a5e500411e11572ec267525985009
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 1 13:07:14 2024 -0600

        Fix batch mode pandas warning. (#70) (#429)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 1bc9e906f0ded81f80761d1ec375ee50a4f882a9
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Apr 26 16:26:27 2024 -0600

        Bump version to 2.3.1 and change default CRISPRessoPooled behavior to change in 2.3.2 (#428)

    commit 5638a1f6ffa973231f23422e9c757fa8cd4af7cc
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Apr 24 18:00:43 2024 -0600

        Spelling fixes

    commit d6011f29db16d8fc1c1e7222457b7f9a1f671de6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed Apr 24 09:33:53 2024 -0600

        Extract `jinja_partials` and fix CRISPRessoPooled fastp errors (#425)

        * Updated README (#64)

        * Updating README to fix argument, email, and formatting

        * removing superfluous files

        * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

        * Remove link to CRISPRessoPro

        * Replace Docker badge with link to tags

        * Add bullet points to Guardrails section and improve formatting

        * Fix typo and removed colons from guardrails

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Extract jinja_partials  (#65)

        * Extract jinja_partials code

        * Remove Plotly dependency from setup.py

        * Fix CRISPRessoPooled flash errors (#68)

        * Fix replacing flash intermediate files with fastp intermediate files

        This also moves where the files are added to `files_to_remove` up to
        near where they are created.

        * Update to run test branch with paired end Pooled test

        * Add pooled-paired-sim test to integration tests

        * Replace flash and trimmomatic with fastp and remove plotly from Github Actions environment

        * Change test branch back to master

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

    commit f4858a30c43374f54058b3ad9c1e965e1ab7fb46
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Apr 23 17:00:28 2024 -0600

        Updated README (#64) (#424)

        * Updating README to fix argument, email, and formatting

        * removing superfluous files

        * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

        * Remove link to CRISPRessoPro

        * Replace Docker badge with link to tags

        * Add bullet points to Guardrails section and improve formatting

        * Fix typo and removed colons from guardrails

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

    commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Apr 22 11:24:59 2024 -0600

        Update CRISPRessoPooledCORE.py (#423)

        Fix bug in error reporting if duplicate names are present

    commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 18 16:55:39 2024 -0600

        Remove extra imports from CRISPRessoCore (#67) (#422)

    commit 4aae57e5be475cd717792265bee36a71a99425de
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 18 10:00:19 2024 -0600

        Cole/refactor jinja undefined (#66) (#421)

        * Replace Jinja2 PackageLoader with FileSystemLoader

        The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
        and Python 3.9. Replacing with FileSystemLoader work with the older version and
        the latest version.

        * Fix undefined variable `amplicon_name` in report template

        * Refactor logging Jinja2 undefined variable warnings

        * Revert plot_11a update

        * Update intedration test branch

        * Update jinja to warn on undefined but not fail. Fix all undefined warnings

        * Fix github integration tests ref

        * One more undefined variable

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Apr 9 17:30:10 2024 -0600

        Fix Jinja2 undefined variables (#63) (#417)

        * Replace Jinja2 PackageLoader with FileSystemLoader

        The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
        and Python 3.9. Replacing with FileSystemLoader work with the older version and
        the latest version.

        * Fix undefined variable `amplicon_name` in report template

        * Revert plot_11a update

        * Update intedration test branch

        * Update branch for integration tests

    commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
    Author: Han Dai <github@daihan.me>
    Date:   Fri Apr 5 18:36:41 2024 -0400

        fix: change all U+00A0 to U+0020 (#400)

    commit 235dc29c0cd0fcca2e999148d4660acf00b07221
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Apr 5 16:36:16 2024 -0600

        Fastp, args as data, guardrails, and PE fix (#415)

        * Change CRISPResso_status.txt format to JSON (#46)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * add json read for status file

        * changed Formatter to json format

        * fixed json access variable name: message

        * changed  perentage_complete to numeric

        * changed status file to .json

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * New makefile commands

        * changed file to .json

        * changed status to json file

        * Make JSON human readable by adding new lines

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * point to test branch

        * pointed CI config to testing branch

        * Update integration_tests.yml

        point to master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        * Trevor/fastp integration (#50)

        * Update check_program to check versions and create check_fastq function

        * Update fastq arg, implement fastp in get_most_frequent_reads

        * Bump version to 2.3.0

        * Deprecate Flash and Trimmomatic parameters, and update fastp params

        * Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

        * Implement trimming of single end reads

        * Merge (and trim) reads in CRISPRessoCORE with fastp

        * Modify error handling to account for fastp errors

        * Replace flash and trimmomatic with fastp in Docker dependencies

        * Update LICENSE.txt with fastp info

        * Remove min and max amplicon length (no longer needed)

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Implement trimming with fastp in CRISPRessoPooled

        * Implemend merging (and trimming) with fastp in CRISPRessoPooled

        * Fixed minor fastp errors

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * Update where the test point to

        * Fix 'Prime-edited' key not found (#32)

        * Move 'Prime-edited' amplicon name check

        By moving this, it will check if there is an amplicon named
        'Prime-edited' (which is a reserved name) even if the
        `prime_editing_pegRNA_extension_seq` parameter is empty.

        * Only search for scaffold integration when pegRNA extension seq is provided

        * Remove spaces at the end of lines

        * Docker size (#49)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * 3.4->2.08

        * Put ttf-mscorefonts-installer back above apt-get clean

        * restore slash, replace fastp with trimmomatic and flash, add autoremove step

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * initial readme modifications

        * Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

        * Pointing test branch back at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        * Guardrails clean history (#34)

        * Include guardrail functions

        * Add CRISPRessoReports subtree

        * Refactor to use CRISPRessoReports module

        * Include guardrail functions

        * Functional guardrails, needs reports update

        * Add guardrail partial

        * fix guardrials partial

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Update C cythonized files

        * Add exact numbers to guardrails printouts

        * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

        * Fix calculation of `total_mods` from being negative

        The issue was that `all_deletion_coordinates` just tells you how many deletions
        were present, but not how long the deletion is.

        * Changes to message

        * Remove old tag

        * Point tests at guardrails

        * Restore C2 pro check

        * Save message with guardrail name

        * Point tests repo at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

        * Fix case sensitivity in Prime Editing mode (#54)

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * Make all amplicons in amplicon_seq_arr uppercase

        This fixes https://github.com/pinellolab/CRISPResso2/issues/396

        * Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

        * Fix 'Prime-edited' key not found (#32)

        * Move 'Prime-edited' amplicon name check

        By moving this, it will check if there is an amplicon named
        'Prime-edited' (which is a reserved name) even if the
        `prime_editing_pegRNA_extension_seq` parameter is empty.

        * Only search for scaffold integration when pegRNA extension seq is provided

        * Remove spaces at the end of lines

        * Docker size (#49)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ----…
kclem pushed a commit that referenced this issue Aug 23, 2024
* Fix CRISPRessoAggregate bug and other improvements (#95)

* D3-Enhancements (#78)

* Sam/try plots (#71)

* Fix batch mode pandas warning. (#70)

* refactor to call method on DataFrame, rather than Series.
Removes warning.

* Fix pandas future warning in CRISPRessoWGS

---------



* Functional

* Cole/fix status file name (#69)

* Update config file logging messages

This removes printing the exception (which is essentially a duplicate),
and adds a condition if no config file was provided. Also changes `json`
to `config` so that it is more clear.

* Fix divide by zero when no amplicons are present in Batch mode

* Don't append file_prefix to status file name

* Place status files in output directories

* Update tests branch for file_prefix addition

* Load D3 and plotly figures with pro with multiple amplicons

* Update batch

* Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

Before this fix, when using a file_prefix the second run that was compared
would not be displayed as a data in the first figure of the report.

* Import CRISPRessoPro instead of importing the version

When installed via conda, the version is not available

* Remove `get_amplicon_output` unused function from CRISPRessoCompare

Also remove unused argparse import

* Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

* Allow for matching of multiple guides in the same amplicon

* Fix pandas FutureWarning

* Change test branch back to master

---------



* Try catch all futures

* Fix test fail plots

* Point test to try-plots

* Fix d3 not showing and plotly mixing with matplotlib

* Use logger for warnings and debug statements

* Point tests back at master

---------




* Sam/fix plots (#72)

* Fix batch mode pandas warning. (#70)

* refactor to call method on DataFrame, rather than Series.
Removes warning.

* Fix pandas future warning in CRISPRessoWGS

---------



* Functional

* Cole/fix status file name (#69)

* Update config file logging messages

This removes printing the exception (which is essentially a duplicate),
and adds a condition if no config file was provided. Also changes `json`
to `config` so that it is more clear.

* Fix divide by zero when no amplicons are present in Batch mode

* Don't append file_prefix to status file name

* Place status files in output directories

* Update tests branch for file_prefix addition

* Load D3 and plotly figures with pro with multiple amplicons

* Update batch

* Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

Before this fix, when using a file_prefix the second run that was compared
would not be displayed as a data in the first figure of the report.

* Import CRISPRessoPro instead of importing the version

When installed via conda, the version is not available

* Remove `get_amplicon_output` unused function from CRISPRessoCompare

Also remove unused argparse import

* Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

* Allow for matching of multiple guides in the same amplicon

* Fix pandas FutureWarning

* Change test branch back to master

---------



* Try catch all futures

* Fix test fail plots

* Fix d3 not showing and plotly mixing with matplotlib

---------




* Remove token from integration tests file

* Provide sgRNA_sequences to plot_nucleotide_quilt plots

* Passing sgRNA_sequences to plot

* Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

* Add max-height to Batch report samples

* Change testing branch

* Fix wrong check for large Batch plots

* Fix typo and move flexiguide to debug (#77)

* Change flexiguide output to debug level

* Fix typo in fastp merged output file name

* Adding id tags for d3 script enhancements

* pointing to test branch

* Add amplicon_name parameter to allele heatmap and line plots

* Add function to extract quantification window regions from include_idxs

* Scale the quantification window according to the coordinates of the sgRNA plot

* added c2pro check, added space in args.json

* Correct the quantification window indexes for multiple guides

* Fix name of nucleotide conversion plot when guides are not the same

* Fix jinja variables that aren't found

* Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

* Remove unneeded variable and extra whitespace

* Switch test branch to master

---------





* Add amplicon_name to plot functions

* Add sgRNA sequences to nucleotide quilt parameters in Aggregate

* Add custom_colors to Aggregate plot functions

* Update Aggregate and make_aggregate_report to have logger and tool

* Write command_used to Aggregate .json info file

* Point to new test branch and add Aggregate run

* Make the order of Aggregate runs explicit

* Sort all instances of crispresso2_folder_info in Aggregate

* Sort df_summary_quantification df in Aggregate

* Try sorting with a list of single column

* Update to correct test branch

* Move to master test branch

---------





* Squashed commit of the following:

commit 6ec98a05ee70f85b5aa0ac15ab6094b7f1f20d08
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Tue Aug 13 16:44:39 2024 -0600

    dict key changes

commit 7cfd5acf06da4eb6f49453144ee1fed1e1488a7a
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Thu Aug 8 15:30:31 2024 -0600

    added C2PRO install check back

commit bfb0003329ea61b5c79c7e1df8d9a73ec5a508db
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Fri Aug 2 13:08:12 2024 -0600

    fixed key error conditionals

commit 84444e7480605206cb3efa4a0db675c55e717304
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Fri Aug 2 09:22:44 2024 -0600

    use local jinja_paritals file

commit 71dd12786fec6c4aba0170a3bfd9022b06f5eede
Author: mbowcut2 <mbowcut@gmail.com>
Date:   Wed Jul 31 14:10:29 2024 -0600

    Squashed commit of the following:

    commit 5e3b30515c4bc437127e7fb21f53cb0bd511c4ca
    Author: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
    Date:   Mon Jul 22 09:31:44 2024 -0600

        D3-Enhancements (#78)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Provide sgRNA_sequences to plot_nucleotide_quilt plots

        * Passing sgRNA_sequences to plot

        * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

        * Add max-height to Batch report samples

        * Change testing branch

        * Fix wrong check for large Batch plots

        * Fix typo and move flexiguide to debug (#77)

        * Change flexiguide output to debug level

        * Fix typo in fastp merged output file name

        * Adding id tags for d3 script enhancements

        * pointing to test branch

        * Add amplicon_name parameter to allele heatmap and line plots

        * Add function to extract quantification window regions from include_idxs

        * Scale the quantification window according to the coordinates of the sgRNA plot

        * added c2pro check, added space in args.json

        * Correct the quantification window indexes for multiple guides

        * Fix name of nucleotide conversion plot when guides are not the same

        * Fix jinja variables that aren't found

        * Fix multiple guide errors where the wrong sgRNA sequence was associated in d3 plot

        * Remove unneeded variable and extra whitespace

        * Switch test branch to master

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

    commit 09e5d9720ad21e44fc7916d71bde3fd7a9dfa7ef
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu Jul 18 14:31:54 2024 -0600

        Asymmetrical cut point (#457)

        * add cut_point_ind to plot_alleles_heatmap for asymmetrical plotting

        * Cole asymmetrical cut point (#453)

        * Pin versions of numpy and matplotlib in CI environment (#84) (#452)

        * Reduce duplication and implement cut_point_ind in plot_alleles_heatmap_hist

        ---------

        Co-authored-by: Cole Lyman <Cole@colelyman.com>

    commit 8d92972694ddff629dad844a6ad100459f69751d
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Jul 18 14:29:40 2024 -0600

        Cole/update args (#85) (#456)

    commit 44f692ecabf5e2eb96ee0cfd7bae62343da7810c
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon Jul 15 16:17:29 2024 -0600

        Implement new pooled mixed-mode default behavior (#454)

        * changes for pooled mixed-mode default (#83)

        * changes for pooled mixed-mode default

        * deprecated old arg

        * added integration tests for mixed mode

        * fixed test target

        * updated test name

        * pinned numpy

        * Fix integration tests yml

        * pinning matplotlib

        * added print to CI tests

        * changed mixed mode info string

        * Remove pooled-mixed-mode-align-to-genome step from Github Actions

        * Update demultiplex_genome_wide parameter and help

        * Convert args.json to unix line endings

        * Add Pooled mixed mode demux run

        * Update the name of the argument in Pooled

        * Point integration tests back to master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Revert change to pooled mixed mode info statement (#86)

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 79b482b55a0e8edbc03ec22bd2714bade1e90323
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Jul 9 12:53:23 2024 -0600

        Pin versions of numpy and matplotlib in CI environment (#84) (#452)

    commit 80dc1bdd72d50f989717bfc5f8156bc3495c45f4
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 30 14:07:42 2024 -0600

        Add padding to image

    commit 381755daf0939aaf2745df0a802c809633aff47d
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 30 13:59:57 2024 -0600

        White background for schematic for dark mode

    commit d649db71e610bd8840fbb8d46fadb07789b67390
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri May 24 12:45:53 2024 -0600

        Fix typo and move flexiguide to debug (#77) (#438)

        * Change flexiguide output to debug level

        * Fix typo in fastp merged output file name

    commit 71181f50ef2b39015523b1a71d9fd1bf0dce14eb
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon May 13 13:34:00 2024 -0600

        Prefix the release Docker tag with a `v` (#434)

    commit d2c2be18a6bb64b0e742cc24c4665980a24324bc
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Mon May 13 09:41:32 2024 -0600

        Showing sgRNA sequences on hover in CRISPRessoPro (#432)

        * Passing sgRNA sequences to regular and Batch D3 plots (#73)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Provide sgRNA_sequences to plot_nucleotide_quilt plots

        * Passing sgRNA_sequences to plot

        * Refactor check for determining when to use CRISPREssoPro or matplotlib for Batch plots

        * Add max-height to Batch report samples

        * Change testing branch

        * Fix wrong check for large Batch plots

        * Update integration_tests.yml to point back at master

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Push new releases to ECR (#74)

        * Create aws_ecr.yml (#1)

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * us-east-1

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Update aws_ecr.yml

        * Fix d3 sgRNA sequences (#76)

        * Pass correct sgRNA_sequences to d3 plot

        * Pass correct sgRNA sequence to prime editor plot for d3

        * Resize plotly (#75)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        * Pass div id for plotly

        * Remove debug

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 1c504274818b6b17fb60620d48fd92cb2e50566d
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu May 9 14:16:25 2024 -0600

        Fix plots and improve plot error handling (#431)

        * Sam/try plots (#71)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Point test to try-plots

        * Fix d3 not showing and plotly mixing with matplotlib

        * Use logger for warnings and debug statements

        * Point tests back at master

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Sam/fix plots (#72)

        * Fix batch mode pandas warning. (#70)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Functional

        * Cole/fix status file name (#69)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

        * Try catch all futures

        * Fix test fail plots

        * Fix d3 not showing and plotly mixing with matplotlib

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Remove token from integration tests file

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit acb2ea8e26dff4cd11f71301b344f81b1cec9040
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Thu May 2 13:49:33 2024 -0600

        Use recent docker image for CircleCI testing that includes updated pandas

    commit 38fd76dbd7ce2087468f9f454b548777de959a68
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 1 16:42:28 2024 -0600

        Cole/fix status file name (#69) (#430)

        * Update config file logging messages

        This removes printing the exception (which is essentially a duplicate),
        and adds a condition if no config file was provided. Also changes `json`
        to `config` so that it is more clear.

        * Fix divide by zero when no amplicons are present in Batch mode

        * Don't append file_prefix to status file name

        * Place status files in output directories

        * Update tests branch for file_prefix addition

        * Load D3 and plotly figures with pro with multiple amplicons

        * Update batch

        * Fix bug in CRISPRessoCompare with pointing to report datas with file_prefix

        Before this fix, when using a file_prefix the second run that was compared
        would not be displayed as a data in the first figure of the report.

        * Import CRISPRessoPro instead of importing the version

        When installed via conda, the version is not available

        * Remove `get_amplicon_output` unused function from CRISPRessoCompare

        Also remove unused argparse import

        * Implement `get_matching_allele_files` in CRISPRessoCompare and accompanying unit tests

        * Allow for matching of multiple guides in the same amplicon

        * Fix pandas FutureWarning

        * Change test branch back to master

        ---------

        Co-authored-by: Sam <snic9004@gmail.com>

    commit 3ec22e5fd09e432c9997d30e5f9ee51a2cc00d7b
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed May 1 13:08:11 2024 -0600

        Remove linked space in readme

    commit 340a4e16795a5e500411e11572ec267525985009
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed May 1 13:07:14 2024 -0600

        Fix batch mode pandas warning. (#70) (#429)

        * refactor to call method on DataFrame, rather than Series.
        Removes warning.

        * Fix pandas future warning in CRISPRessoWGS

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

    commit 1bc9e906f0ded81f80761d1ec375ee50a4f882a9
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Apr 26 16:26:27 2024 -0600

        Bump version to 2.3.1 and change default CRISPRessoPooled behavior to change in 2.3.2 (#428)

    commit 5638a1f6ffa973231f23422e9c757fa8cd4af7cc
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Wed Apr 24 18:00:43 2024 -0600

        Spelling fixes

    commit d6011f29db16d8fc1c1e7222457b7f9a1f671de6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Wed Apr 24 09:33:53 2024 -0600

        Extract `jinja_partials` and fix CRISPRessoPooled fastp errors (#425)

        * Updated README (#64)

        * Updating README to fix argument, email, and formatting

        * removing superfluous files

        * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

        * Remove link to CRISPRessoPro

        * Replace Docker badge with link to tags

        * Add bullet points to Guardrails section and improve formatting

        * Fix typo and removed colons from guardrails

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Extract jinja_partials  (#65)

        * Extract jinja_partials code

        * Remove Plotly dependency from setup.py

        * Fix CRISPRessoPooled flash errors (#68)

        * Fix replacing flash intermediate files with fastp intermediate files

        This also moves where the files are added to `files_to_remove` up to
        near where they are created.

        * Update to run test branch with paired end Pooled test

        * Add pooled-paired-sim test to integration tests

        * Replace flash and trimmomatic with fastp and remove plotly from Github Actions environment

        * Change test branch back to master

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

    commit f4858a30c43374f54058b3ad9c1e965e1ab7fb46
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Apr 23 17:00:28 2024 -0600

        Updated README (#64) (#424)

        * Updating README to fix argument, email, and formatting

        * removing superfluous files

        * Add link to CRISPRessoPro, move CRISPRessoPro section to end, and fix JSON formatting

        * Remove link to CRISPRessoPro

        * Replace Docker badge with link to tags

        * Add bullet points to Guardrails section and improve formatting

        * Fix typo and removed colons from guardrails

        ---------

        Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>

    commit c3dbff0fccd44b0b1a9c246dd2aa629ddc515787
    Author: Kendell Clement <k.clement.dev@gmail.com>
    Date:   Mon Apr 22 11:24:59 2024 -0600

        Update CRISPRessoPooledCORE.py (#423)

        Fix bug in error reporting if duplicate names are present

    commit 20903c14877e5166b1b8a7b50b8fcab450ea3ca6
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 18 16:55:39 2024 -0600

        Remove extra imports from CRISPRessoCore (#67) (#422)

    commit 4aae57e5be475cd717792265bee36a71a99425de
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Thu Apr 18 10:00:19 2024 -0600

        Cole/refactor jinja undefined (#66) (#421)

        * Replace Jinja2 PackageLoader with FileSystemLoader

        The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
        and Python 3.9. Replacing with FileSystemLoader work with the older version and
        the latest version.

        * Fix undefined variable `amplicon_name` in report template

        * Refactor logging Jinja2 undefined variable warnings

        * Revert plot_11a update

        * Update intedration test branch

        * Update jinja to warn on undefined but not fail. Fix all undefined warnings

        * Fix github integration tests ref

        * One more undefined variable

        ---------

        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

    commit 768c3c05bf1786a2a32e135b6e145cd6503c3db1
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Tue Apr 9 17:30:10 2024 -0600

        Fix Jinja2 undefined variables (#63) (#417)

        * Replace Jinja2 PackageLoader with FileSystemLoader

        The PackageLoader doesn't work with a fairly recent version of Jinja2 (3.0.1)
        and Python 3.9. Replacing with FileSystemLoader work with the older version and
        the latest version.

        * Fix undefined variable `amplicon_name` in report template

        * Revert plot_11a update

        * Update intedration test branch

        * Update branch for integration tests

    commit 7e18f08cc1ac5f247a0fd1bbb394ccd9b0a07c2e
    Author: Han Dai <github@daihan.me>
    Date:   Fri Apr 5 18:36:41 2024 -0400

        fix: change all U+00A0 to U+0020 (#400)

    commit 235dc29c0cd0fcca2e999148d4660acf00b07221
    Author: Cole Lyman <Cole@colelyman.com>
    Date:   Fri Apr 5 16:36:16 2024 -0600

        Fastp, args as data, guardrails, and PE fix (#415)

        * Change CRISPResso_status.txt format to JSON (#46)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * add json read for status file

        * changed Formatter to json format

        * fixed json access variable name: message

        * changed  perentage_complete to numeric

        * changed status file to .json

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * New makefile commands

        * changed file to .json

        * changed status to json file

        * Make JSON human readable by adding new lines

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * point to test branch

        * pointed CI config to testing branch

        * Update integration_tests.yml

        point to master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        * Trevor/fastp integration (#50)

        * Update check_program to check versions and create check_fastq function

        * Update fastq arg, implement fastp in get_most_frequent_reads

        * Bump version to 2.3.0

        * Deprecate Flash and Trimmomatic parameters, and update fastp params

        * Update guess_amplicons and guess_guides to remove max_paired_end_reads_overlap

        * Implement trimming of single end reads

        * Merge (and trim) reads in CRISPRessoCORE with fastp

        * Modify error handling to account for fastp errors

        * Replace flash and trimmomatic with fastp in Docker dependencies

        * Update LICENSE.txt with fastp info

        * Remove min and max amplicon length (no longer needed)

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Implement trimming with fastp in CRISPRessoPooled

        * Implemend merging (and trimming) with fastp in CRISPRessoPooled

        * Fixed minor fastp errors

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * Update where the test point to

        * Fix 'Prime-edited' key not found (#32)

        * Move 'Prime-edited' amplicon name check

        By moving this, it will check if there is an amplicon named
        'Prime-edited' (which is a reserved name) even if the
        `prime_editing_pegRNA_extension_seq` parameter is empty.

        * Only search for scaffold integration when pegRNA extension seq is provided

        * Remove spaces at the end of lines

        * Docker size (#49)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * 3.4->2.08

        * Put ttf-mscorefonts-installer back above apt-get clean

        * restore slash, replace fastp with trimmomatic and flash, add autoremove step

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * initial readme modifications

        * Updated readme to remove deprecated commands, updated help text to reflect new version and fastp

        * Pointing test branch back at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Samuel Nichols <Snic9004@gmail.com>

        * Guardrails clean history (#34)

        * Include guardrail functions

        * Add CRISPRessoReports subtree

        * Refactor to use CRISPRessoReports module

        * Include guardrail functions

        * Functional guardrails, needs reports update

        * Add guardrail partial

        * fix guardrials partial

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Run tests individually

        * Pin plotly version

        * Run all tests even if one fails

        * Test on another branch

        * Switch branch with token

        * Update integration_tests.yml

        * Introduce pandas sorting in CRISPRessoCompare (#47)

        * New makefile commands

        * Fix interleaved fastq input in CRISPRessoPooled and suppress CRISPRessoWGS params (#42)

        * Extract out split_interleaved_fastq function to CRISPRessoShared

        * Implement splitting interleaved fastq files in CRISPRessoPooled

        * Suppress split_interleaved_input from CRISPRessoWGS parameters

        * Suppress other parameters in CRISPRessoWGS

        * Move where interleaved fastq files are split to be trimmed properly

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * On push no branches

        * On push no branches

        * All in one file

        * Fix yml errors

        * Rename jobs

        * Remove old workflow files

        * Remove paths

        * Run jobs in parallel

        ---------

        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * Update C cythonized files

        * Add exact numbers to guardrails printouts

        * Remove extraneous whitespace from CRISPRessoCOREResources.pyx

        * Fix calculation of `total_mods` from being negative

        The issue was that `all_deletion_coordinates` just tells you how many deletions
        were present, but not how long the deletion is.

        * Changes to message

        * Remove old tag

        * Point tests at guardrails

        * Restore C2 pro check

        * Save message with guardrail name

        * Point tests repo at master

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>
        Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>

        * Fix case sensitivity in Prime Editing mode (#54)

        * Move read filtering to after merging in CRISPResso (#39)

        * Move read filtering to after merging

        This is in an effort to be consistent with the behavior and results of
        CRISPRessoPooled.

        * Properly assign the correct file names for read filtering

        * Add space around operators

        * GitHub actions on pr (#51)

        * Run integration tests on pull_request

        * Run pytest on pull_request

        * Run pylint on pull_request

        * Run tests on PR only when opening PR (#53)

        * Update reports (#52)

        * Update report changes

        * Switch branch of integration test repo

        * Remove extraneous `crispresso_data_path`

        * Point integration tests back to master

        * Make all amplicons in amplicon_seq_arr uppercase

        This fixes https://github.com/pinellolab/CRISPResso2/issues/396

        * Allow RNA values to be provided for prime_editing_pegRNA_scaffold_seq

        * Fix 'Prime-edited' key not found (#32)

        * Move 'Prime-edited' amplicon name check

        By moving this, it will check if there is an amplicon named
        'Prime-edited' (which is a reserved name) even if the
        `prime_editing_pegRNA_extension_seq` parameter is empty.

        * Only search for scaffold integration when pegRNA extension seq is provided

        * Remove spaces at the end of lines

        * Docker size (#49)

        * Bug Fix - 367 (#35)

        * - Fixed references to ref_names_for_pe

        * removed extra tabs

        * trying to match empty line, no tabs

        * - changed references to ref_names[0]

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        ---------

        Co-authored-by: Cole Lyman <cole@colelyman.com>

        * GitHub actions integration tests (#48)

        * GitHub actions clean (#40)

        * Create pytest.yml

        * Create pylint.yml

        * Create .pylintrc

        * Create test_env.yml

        * Full path

        * Remove conda install

        * Replace path

        * Pytest tests

        * pip -e

        * Create integration_tests.yml

        * Simplify name

        * CRISPRESSO2_DIR environment variable

        * Up one dir

        * ls workspace

        * Install CRISPResso and ydiff

        * Clone repo instead of checkout

        * submodule

        * ls

        * CRISPResso2_copy

        * ls

        * Update env

        * Simplify

        * Pull from githubactions branch

        * Pull githubactions repo

        * Checkout githubactions

        * Mckay/pd warnings (#45)

        * refactor errors='ignore' to try except

        * refactored integer slice to iloc[]

        * moved to_numeric try except to function

        * Refactor to_numeric_ignore_errors to to_numeric_ignore_columns

        This change is slightly cleaner because it addresses the root issue that some
        columns are strings (and can therefore not be converted to numeric types). Now
        if an error does occur when converting the dfs to numeric types it won't be
        swallowed up.

        * Add documentation to to_numeric_ignore_columns

        ----…

Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
Co-authored-by: Trevor Martin <60452953+trevormartinj7@users.noreply.github.com>
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

1 participant